Genetic Material

Welcome to the "Genetic Material" category on Questions LLC! This category is dedicated to all things related to the fascinating world of genetic material. Here, you will find a wealth of information and discussion regarding DNA, RNA, chromosomes, genes, and various other aspects of genetic material. Whether you are a student, researcher, or simply curious about the building blocks of life, this category is the perfect place to explore and engage in discussions about the intricacies of genetic material. So, dive in, discover, and broaden your understanding of the fundamental components that shape life as we know it.

Questions (32)

how do prokaryotes and eukaryotes differ in how they store genetic material?a. prokaryotes have rna instead of dna b. eukaryotes
1. 3 answers
2. asked by dsa
3. 54 views
The irregularly-shaped region within the cell of a prokaryote that contains all or most of the genetic material is called ...Que
1. 3 answers
2. asked anonymously
3. 28 views
Which statement about genetic material is correct1. Genes encode deoxytribonuleic acid 2. Chromatids contain Chromosomes 3.
1. 1 answer
2. asked by AJ
3. 65 views
Which statement about genetic material is correct?(1 point)Responses Chromatids contain chromosomes. Chromatids contain
1. 5 answers
2. asked by naww
3. 333 views
Which statement about genetic material is correct?(1 point) Responses Genes encode deoxyribonucleic acid. Genes encode
1. 1 answer
2. asked by A Local Wanderer In Search
3. 139 views
Which statement about genetic material is correct?(1 point)%0D%0AResponses%0D%0A%0D%0AGenes encode deoxyribonucleic
1. 4 answers
2. asked by lol🥲
3. 35 views
you will get 20/20here are the answers 1.they both contain genetic material 2.round 3.the combination of its allels 4.they are
1. 1 answer
2. asked anonymously
3. 39 views
Which statement about genetic material is correct?(1 point) Genes encode deoxyribonucleic acid. Chromatids contain chromosomes.
1. 1 answer
2. asked by Hi
3. 54 views
In the early 20th century, some scientists were reluctant to accept the conclusion that DNA could be the genetic material
1. 1 answer
2. asked by Robert
3. 992 views
Which term describes genetic material joined together from two different sources?
1. 1 answer
2. asked anonymously
3. 33 views
Which statement about genetic material is correct a genes encode deoxyribonnucleic acidB chromatids contain chromosomes See
1. 1 answer
2. asked anonymously
3. 46 views
Which statement about genetic material is correct?A. Chromosomes are made up of genes. B. Genes encode deoxyribonucleic acid. C.
1. 1 answer
2. asked anonymously
3. 49 views
Genome A5�-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC
1. 2 answers
2. asked by Jessica
3. 553 views
In eukaryotes, DNA ( 1 point )A.) floats freely in the cytoplasm. B.) is located in the ribosomes. C.) is circular. D.) is
1. 1 answer
2. asked anonymously
3. 58 views
Which statement about genetic material is correct?Responses Chromatids contain chromosomes. Chromatids contain chromosomes.
1. 1 answer
2. asked by I defitnley (problably not) (indeed so) did ya moms
3. 59 views
what does RNA contain which also replaces something in DNA
1. 1 answer
2. asked by ,,,,,,,,,,,,
3. 19 views
Which structure in the cell contains genetic material and controls the cell’s activities?a) Nucleus b) Golgi apparatus c)
1. 1 answer
2. asked anonymously
3. 51 views
Inherited traits of individuals are governed in the genetic material found in the genes within chromosomes in the nucleus. This
1. 1 answer
2. asked anonymously
3. 89 views
Viruses are exceptions to the cell theory, but they have some characteristics of living things. What is one of these
1. 1 answer
2. asked anonymously
3. 21 views
All living organisms have genetic material. See the image below. What has happened? What are the possible effects?Use the ace
1. 3 answers
2. asked anonymously
3. 14 views
Which statement about genetic material is correct?Responses Chromatids contain chromosomes. Chromosomes are made up of genes.
1. 1 answer
2. asked anonymously
3. 25 views
Although viruses can have different shapes, they all possess the genetic instructions needed to produce more viruses. Which of
1. 1 answer
2. asked anonymously
3. 14 views
Which represents a strand of RNA bases?CAAGGTCTC AGGTTCACA CAAGGUCUC TGGAACTCA
1. 1 answer
2. asked anonymously
3. 8 views
Which best matches a type of genetic material with its description?Nucleotides form a helical structure that is called a gene.
1. 1 answer
2. asked anonymously
3. 18 views
The box lists three terms.• Genetic material • Chromosome • Gene All of these are located A. in the brain, only. B. in a
1. 1 answer
2. asked anonymously
3. 21 views
The box lists three terms.• Genetic material • Chromosome • Gene All of these are located A. in the brain, only. B. in a
1. 1 answer
2. asked anonymously
3. 27 views
Which of the following is true about the genetic material of eukaryotes and prokaryotes?A. Eukaryotes and prokaryotes both have
1. 1 answer
2. asked anonymously
3. 21 views
All organisms need instructions to specify their traits. The instructions, or code, that is responsible for all the inherited
1. 1 answer
2. asked anonymously
3. 18 views
Which choice below best shows various types of genetic material in order from simplest to most complex?A. gene genome chromosome
1. 1 answer
2. asked anonymously
3. 21 views
DNA and Protein SynthesisIn the 1940s, scientists thought all genetic material was contained in structures called chromosomes
1. 1 answer
2. asked by Strawberry Cow
3. 20 views
Which choice below best shows various types of genetic material in order from simplest to most complex?A. gene genome chromosome
1. 1 answer
2. asked anonymously
3. 17 views
Rank the terms describing genetic material in descending order, from largest to smallest.gene for hair color genome A single DNA
1. 1 answer
2. asked by emily
3. 17 views