DNA

Welcome to the DNA category on Questions LLC! Here, you will find a comprehensive collection of questions regarding DNA, the fundamental building block of life. Whether you are a curious individual seeking to delve into the fascinating world of genetics or a student looking for answers to assignments and research projects, this category is designed to provide detailed insights into this intricate subject. Explore a wide range of topics, including DNA structure, genetic mutations, gene therapy, ancestry testing, and much more. Our community of experts and enthusiasts are here to help unravel the mysteries of DNA and guide you on your quest for knowledge. Ask, learn, and discover the wonders hidden within your very own genes!

Questions (131)

Read the following passage. Select the option that has the correct terms for each blank in the appropriate order.“__________
1. 5 answers
2. asked by b33ft0ads
3. 290 views
Which of these statements about DNA is true?(1 point) Responses Proteins signal the cells to make DNA. Proteins signal the cells
1. 7 answers
2. asked by ༼ つ ◕_◕ ༽つ
3. 176 views
A timeline of important discoveries about DNA is shown below. These discoveries have contributed to our current knowledge about
1. 1 answer
2. asked by jhyutdr
3. 148 views
Assume that two strands of DNA have been separated and that the base sequence on one strand is AGCC. What is the sequence of
1. 1 answer
2. asked anonymously
3. 29 views
which of these statements about DNA is true?a. Proteins signal the cells to make DNA. b. DNA is too similar to use for grouping
1. 1 answer
2. asked anonymously
3. 26 views
Which best describes mitochondrial DNA (mtDNA)?Mitochondrial DNA is the same as nuclear DNA. Mitochondrial DNA is inherited
1. 2 answers
2. asked by kuol wor
3. 127 views
Which of these statements about DNA is true.1.All animals have DNA. 2.Proteins signal the cells to make DNA. 3.DNA is too
1. 2 answers
2. asked by stream "bite me" by enhypen
3. 131 views
Which of these statements about DNA is true?Responses DNA is too similar to use for grouping organisms. DNA is too similar to
1. 7 answers
2. asked by Mama
3. 86 views
Which of these statements about DNA is trueDNA is too similar to use for grouping organisms Proteins signal the cells to make
1. 4 answers
2. asked by Alex
3. 158 views
The bases of DNA are adenine, cytosine, guanine, and thymine.A. True B. False
1. 1 answer
2. asked anonymously
3. 71 views
All organisms need instructions to specify their traits. The instructions, or code, that is responsible for all the inherited
1. 1 answer
2. asked anonymously
3. 74 views
Evidence for Common Characteristics Quick Check1 of 41 of 4 Items Question Which of these statements about DNA is true? (1
1. 1 answer
2. asked by Random
3. 124 views
Which of these statements about DNA is true? (1 point)O All animals have DNA. DNA is too similar to use for grouping organisms.
1. 7 answers
2. asked by connexus
3. 1,000 views
someone please help me im confused and idk what im doingghow would i create a dna molecule model using straws, pushpins, and
1. 1 answer
2. asked by megann
3. 438 views
Can someone plss help meWith the DNA Unit test unit 6 I literally have a 63 in biology any help would be great
1. 7 answers
2. asked by Princess sparkles
3. 2,490 views
How does DNA determine a trait that determines eye color?1)DNA codes for proteins that determine eye color. 2)DNA codes for mRSA
1. 7 answers
2. asked by Jamie
3. 2,265 views
1. DNA is found in ____ cells.sex sperm all* no 2. A ____ is part of the DNA code on a chromosome. gene* genotype phenotype
1. 3 answers
2. asked by YOLO
3. 1,320 views
explain why DNA is able to play a role in the transmission of hereditary information
1. 5 answers
2. asked by nthabiseng
3. 1,733 views
can somebody please explain the relationship betweenthe structure of DNA, protein structure and the phenotype of an organism and
1. 3 answers
2. asked by Marva
3. 906 views
one strand of DNA could be as long as a football field if it were stretched out lengthwise. One of the factors allowing DNA to
1. 5 answers
2. asked by Hannah
3. 2,145 views
The anticodon for GCG is:A) AUA B) CCT C) UAU D) CGC **D
1. 3 answers
2. asked by Stacy
3. 1,211 views
14. The major components of a DNA molecular subunit area. a chromosome, deoxyribose, and double helix b. a five-carbon sugar,
1. 3 answers
2. asked by mysterychicken
3. 1,158 views
Both eukaryotic cells and prokaryotic cells possess DNA and engage in genetic processes. Which of the following is true of their
1. 1 answer
2. asked anonymously
3. 116 views
A DNA said we has bass order AGC TTA TCA Which copy exhibits a frameshift mutation Through deletion?
1. 1 answer
2. asked by Alex
3. 72 views
(c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
1. 1 answer
2. asked by sam
3. 254 views
Are the DNA template strand and the mRNA sequences similar, or complementary?Are the DNA coding strand and the mRNA sequences
1. 1 answer
2. asked by mable
3. 478 views
What makes all living things differentWhat makes up the code for all humans DNA
1. 1 answer
2. asked by A.
3. 432 views
Which of the following are the purine nucleotides in DNA?A.Adenine and thymine B.Cytosine and guanine C.Adenine and cytosine
1. 1 answer
2. asked by Lucy
3. 709 views
Mitochondrial DNA is different from nuclear DNA becauseA. it is inherited only from the mother B. it is inherited only from the
1. 3 answers
2. asked anonymously
3. 46 views
Someone please check my answer and tell me if they are right or wrong.1. What are the constituents of DNA? A. Sugars and lipids
1. 0 answers
2. asked by Diana K
3. 475 views
If a DNA double helix is gradually heated, which bonds in the molecule will break first (are the weakest)?A. bonds between the
1. 5 answers
2. asked by orpheus
3. 1,252 views
What is the difference between plasmid and chromosomal DNA?What is Mutant bacteriophage?
1. 1 answer
2. asked by Madihanoor
3. 363 views
Some technical terms pass into common usage as knowledge about a field spreads. Think of three such terms that have passed into
1. 1 answer
2. asked by Bridgett
3. 353 views
I really need to make sure this is correct for tommorow please help!The significance of specific base pairing in DNA is that A)
1. 6 answers
2. asked by jake
3. 501 views
The following DNA segment has one ORF. Do you know what it codes for?5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
1. 1 answer
2. asked by Tony
3. 284 views
why AUG where be a start codon
1. 3 answers
2. asked by Samuel Gudeta
3. 89 views
-What contains DNA?-Where is DNA found?
1. 1 answer
2. asked by Crissy XD
3. 416 views
What is the purpose of DnaTransports proteins Stores hereditary information Reduces activation energy Manufactures proteins
1. 3 answers
2. asked by Knotreal
3. 33 views
Though I specialized in Germanic languages, I need to present (in a very simple way using a very simple language) some
1. 3 answers
2. asked by Mike
3. 475 views
Missing DNA?Do we have any cells with no DNA? What would they be like? What could they be used for?
1. 1 answer
2. asked by meshelle
3. 357 views
how to build a dna molecule using sticks
1. 3 answers
2. asked by tina
3. 388 views
What is the term for a section of a DNA molecule that codes for proteins?(1 point)Responses gene gene cytosine cytosine
1. 3 answers
2. asked by now from the top make it drop that's a wap
3. 191 views
Can someone please explain: Why are non-coding regions of DNA more discriminating than coding regions? I forgot my textbook at
1. 1 answer
2. asked by Biology
3. 944 views
Amber, BiologyFirst of all, as Christina said, "Post a New Question" because when you post under someone else's post we assume
1. 1 answer
2. asked by SraJMcGin
3. 1,157 views
What is the term for a section of a DNA molecule that codes for proteins?(1 point)Responses deoxyribose deoxyribose chromosome
1. 3 answers
2. asked anonymously
3. 96 views
True or False: You can consume DNA from other living organisms like veggies, fruits, meats.
1. 1 answer
2. asked anonymously
3. 32 views
Question 1Chromosomes are made of tightly packed ________ molecules. Responses A DNADNA B amino acidamino acid C lipidlipid
1. 1 answer
2. asked anonymously
3. 32 views
DNA carries the genetic code for all of the traits possessed by an organism. DNA code is used to make proteins in the ribosomes.
1. 1 answer
2. asked anonymously
3. 127 views
Match the complementary DNA baseG Word bank: C T T G T A C G
1. 4 answers
2. asked anonymously
3. 43 views
Genes are specific sections of (Fill in the blank)Answer choices alleles, chromosome, incomplete dominance, mitosis,
1. 7 answers
2. asked by Anonymous
3. 2,541 views

DNA

Pages