BIOLOGY

Relate the classification of an organism to its phylogeny

Please read the following page:

Thanks for the website Lance. However, i cant really find the answer to my question in there. can you help please?

a quote from that site:

"In the case of organisms, we can do much better than an arbitrary classification. Ideally, we wish to base our classification on the relationships of the organisms, that is, on their genealogy or phylogeny. This is uniquely useful because knowing that two organisms are closely related tells us that they will have many properties in common. Knowing historical relationships has more predictive potential (more applicability to properties that have not yet been measured) than does an arbitrary classification."

There is a lot more info on that site. Please read it carefully.

  1. 👍 0
  2. 👎 0
  3. 👁 31
asked by Tony S.

Respond to this Question

First Name

Your Response

Similar Questions

  1. Bio

    What is an advantage of using an organism's scientific name rather then its common name? A.The scientific name is always given in the native language B.The scientific name is based upon the organism's kingdom and phylum C.The

    asked by Anonymous on April 21, 2016
  2. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a

    asked by Olivia N J on November 17, 2016
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  4. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  5. Biology

    I need help with classification Organism Kingdom Phylum Class Order Family Genus Species Crabs (Hermit and Fiddler) Animalia Arthropada Mussel Animalia Mollusca Shrimp Animalia Arthropada Fish (Striped Bass) Animalia Chordata

    asked by Devin on September 30, 2007
  6. Math

    Sam and his father are talking: Son how many pages are there in that book you have to read for school? Less than 1000. Have you started reading it yet? Yes, on Sunday I already passed page 150. And how many pages did you read

    asked by Elsie on October 15, 2009
  7. Environmental systems

    It says toe read page 38 of my Global Sciences book, but I was never given one. =( I've run out of ideas but this one, and using my 10 minutes to read the page in the morning and draw it all in that time limit. If anyone knows ,

    asked by Geno on September 30, 2007
  8. BSHRM

    I can't find any classification of food service operations. ;-) http://www.answers.com/classification classification = type = kind =)

    asked by Margie on June 7, 2007
  9. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  10. English

    1. Read all the sentences on the page. 2. Read all the sentences of the page. Which one is correct? Are both okay? Which one is commonly used? 3. Read Part 1 in a loud voice. 4. Read Part 1 with a loud voice. Which preposition do

    asked by rfvv on November 4, 2016

More Similar Questions