Science

The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), write out the nucleotide sequence of the initial transcript and the processed mRNA, indicating and removing any introns in the process. Finally, translate the mRNA and write out the amino acid sequence of the encoded polypeptide.


5’-GGCGATATAAAGGCGTATGACAGATGATGTTCACCCCCTTGGGAGATGTTCCTCACCAAAGAGAAGCCGGTGAGTATTACACAATACTTATCCGGAGTG...
3’-CCGCTATATTTCCTCATACTGTCTACTACAAGTGGGGGAACCCTCTACAAGGAGTGGTTTCTCTTCGGCCAGTCATAATGTGTTATGAATAGGCCTCAC...


...CCTTCCCTTTCTGAGGGGACCTTTTCGTGCACGAGCTAATTTTGAAGTCCCAATAAACGCCGTACTGTGTGTGAGAGAGAGGCCGGGGGCCCTTGCC-3’
...GGAAGGGAAAGACTCCCCTGGAAAAGCACGTGCTCGATTAAAACTTCAGGGTTCTTTGCGGCATGACACACACTCTCTCTCCGGCCCCCGGGAACGG-5’

  1. 👍 0
  2. 👎 0
  3. 👁 131
  1. A fragment of mRNA with the sequence 5' ACGCAUGGCAAAAAAAA 3' will have a template DNA sequence that reads
    A. 3' UGCGUACCGUUUUUUUU 5'.
    B. 3' TTTTTTTTGCCATGCGT 5'.
    C. 3' UUUUUUUUGCCATGCGT 5'.
    D. 3' TGCGTACCGTTTTTTTT 5'.

    1. 👍 0
    2. 👎 0
    posted by alixie
  2. 3'TGCGTACCGTTTTTTTT 5'

    1. 👍 0
    2. 👎 0
    posted by edwige

Respond to this Question

First Name

Your Response

Similar Questions

  1. Chemistry-Just checking my answer

    For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of

    asked by Deb on December 2, 2012
  2. BIOCHEMISTRY

    To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'.

    asked by bio on August 8, 2014
  3. Chemistry-Just checking my answer

    for template DNA (non-GMO,GMO,and test food) we set up a PCR reaction that included "plant' primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO, test food) would you expect to show successful

    asked by Deb on December 2, 2012
  4. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene.

    asked by Sonya on June 10, 2011
  5. Biology

    I need some help with these questions. I've chosen answers, but I want to make sure if they are correct. 1)Which of the following is an acidic pH? 6 7 8 800 A: 6 None of the above ------------------------------------- 2) Which of

    asked by Krista on March 20, 2015
  6. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC

    asked by ISSY on June 8, 2013
  7. Science

    I answered the questions, but I don't know if my choices are right. 1) Which of the following is an acidic pH? 6 7 8 800 None of the Above Answer: 6 ------------------------------------- 2) Which of the following is directly

    asked by Jane on March 21, 2015
  8. molecular biology

    To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'.

    asked by bio on August 7, 2014
  9. genetics

    The two most basic steps of DNA replication are: A.primase causes primer to bind the template and ligase copies the template. B.helicase unwinds the template and DNA polymerase binds the template. C.leading strand is copied first

    asked by Lucy on March 22, 2015
  10. Biology

    Using RNA a s a template for prot e in synthesis instead of t r ans l a t ing prot e ins directly from the DNA is advantageous for the cell because A) RNA is much more stable than DNA. B) RNA acts as an expendable copy of the

    asked by Matthew on December 11, 2011

More Similar Questions