Science

If you find a mysterious organism, how can you figure out whether or not it is a plant?

  1. 👍 0
  2. 👎 0
  3. 👁 63
  1. plant cells have a cell wall.

  2. Thanks

    1. 👍 0
    2. 👎 0

Respond to this Question

First Name

Your Response

Similar Questions

  1. Science

    If you find a mysterious organism, how can you figure out whether or not it is a plant?

    asked by Light on April 4, 2016
  2. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  3. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  4. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  5. Math

    A one-celled organism measures 32 millimeters in length in a photograph. If the photo is enlarged by a factor of 100, what is the actual length of the organism? Can't figure it out someone plz help! -Celeste

    asked by Celeste on September 19, 2017
  6. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  7. reading

    the mood of this passage is tense sad humorous mysterious i put mysterious ( the story is about Paul Bunyan).

    asked by Gabby ( 5 grade) on April 15, 2012
  8. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  9. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  10. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008

More Similar Questions