Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

biology
How many possible genotypes and phenotypes are there for a single gene trait that shows dominance in any given population?

biology
If the first child of a couple was without dimples, an recessive trait, what is the chance that the second child will be born without dimples? A) 100% B) 25% C) 50% D) Cannot be determined from the phenotype of the child

biology
Which of the following elements is most likely to form an ion that will then form an ionic bond with an ion of a Group 1A element? Be I Fr **my choice Pt

Biology
Has anyone done the effect of cell size on material transport portfolio in Connections academy?

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Biology
In which type of cell does a cell plate form during cytokinesis? a. in plant cells b. in animal cells c. in plants and animals d. in all cells answer: d

Science, Biology
How does DNA encode the characteristics of an organism?

Science Biology
Can you give me a example of Natural Selection?

Science Biology
What does it mean to say that mutations are random?

biology (genetics)
A pure-breeding white mouse with a long tail was crossed to pure-breeding pink mouse with a short tail. The F1 progeny were all pink with long tails. These F1 mice were test crossed to white mouse with a short tail. If the gene controlling color and the gene controlling tail ...

Biology
Mutations can occur in the chromosomes of all types of cells. Mutations that are passed on to offspring must occur in

Advanced Biology
Hi could you help me with this problem as well? The alleles for red and white coat color in cattle show absence of dominance, the heterozygote being roan. A.In a freely breeding herd of 1000 head how many would you expect to be of each coat color if the allele for white coat ...

Advanced Biology
A recessive lethal gene in chickens causes circulatory failure and death of the embryo at 70 hours.A commercial hatchery finds that a hatching failure due to this gene of greater than 4% is unacceptable.What is the upper limit for the frequency of this allele in the breeding ...

Science, Biology
How did a new species with different variation affect the availability of food for the previously existing species..?

Science , Biology
Why does a sorting process only work when variation is present in a population?

Biology
I need an acrostic poem with the word endomembrane.

Biology
I'm making a study guide for this class and I'm not sure about this question.. can someone give their input? There is another effect that fertilizer had on an aquatic system. What is that called? I think it may be referring to pollution?

biology
someone please help me im confused and idk what im doingg how would i create a dna molecule model using straws, pushpins, and paperclips? help me, please.

Biology
Hi all, Need help with this: What is the difference that you see on a EKG when you have non-transmural MI vs. transmural MI? a) In transmural MI the Q wave is amplified, and the R wave is depleted making the QRS complex look inverted b) In non-transmural, the T wave is absent ...

maths
In a class of 60 students,the number of students who passed biology is 6 more than the number who passed chemistry.Every student passed at least one of the two subjects.i.how many students passed biology ii.how many students passed chemistry iii.how many students passed only ...

biology
Pearl formation is in the syllabus of aipmt or aiims?

9th grade Biology
I really need help with the answers for the unit 2 Lesson 16: Ecology Unit Test

Biology - Lungs
Why are there so many bronchioles in the body?

Biology - DNA
I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these base pairs such as A...

biology
Which of the following is not an organice molecule? Cellulose sucrose water testosterone

biology
which of the following is not an organic compound: cellulose sucrose water testosterone

biology
How to do a Punnett square of a F2 dihybrid cross for peas with the dominant of white flowers over pink and smooth peas over wrinkled peas?

biology
How is a cow protein different than a human protein? How is cow DNA physically different from human DNA? Remember all proteins are made up of amino acids

Biology
A pore whose opening is covered by a diaphragm is clearly visible. What role do the pores serve? What would be the role of the diaphragm?

biology
amino acid is to protein as fat is to lipid DNA is to RNA sugar is to fat simple sugar is to starch

Biology
1. When farming, overgrazing, climate change, and/or seasonal drought change farmland into land that cannot support plant life, it is called (1 point) a. desertification. <- my answer b. depletion. c. deforestation. d. monoculture. 2. Which statement below is NOT true? (1 ...

Biology 20
I'm using chromatography to identify compounds in a leaf extract for a lab, and one of the evaluation questions is 'Suggest a step that could be added to the procedure to isolate a specific compound for chemical testing.' What step could I use?

Biology
A man made allopolyploid ceral crop is?

Biology
In a population of Mendel's garden peas, the frequency of green-flowered plants (genotype aa) is 49%. The population is in Hardy-Weinberg equilibrium. What are the frequencies of the AA and Aa genotypes? I got 9% AA, 42% Aa as my answer, is this correct?

Biology
A consumer can also be considered a a. herbivore b. autotroph c. heterotroph d. primary producer I think the answer is either a or c, because a consumer could also be a herbivore, but I don't know if the question is asking for a different name for a consumer which would be a ...

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...

Biology
Two students were testing the amount of fertilizer that would best promote the growth of tomato plants in a garden. Which of the following could be an unavoidable source of experimental error? Select one: a. variation of tomato plants b. amount of water given to the plants c. ...

biology (check answers)
1. How do endothermic and exothermic reactions differ? a. Endothermic reactions release energy and are spontaneous. b. Exothermic reactions release energy and are spontaneous. c. Endothermic reactions give off heat and light. d. Photosynthesis is exothermic. MY CHOICE: B 2. ...

Biology
If a curly haired father and straight haired mother 8 children are born .the ratio of curly and straight haired will be ......

urgent mc biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help

urgent mc biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2

multiple choice biology
Which of the following do you have less of at the end of cellular respiration than at the beginning? (a)Co-enzyme A (b)ATP synthase (c)ADP (d)the proteins of the electron transport chain (e)FADH2 Please help

biology
After the blood in is the left heart you would next find it (a)entering the lungs. (b)entering the tissues, like muscles. (c)entering the right heart. (d)leaving the lungs. (e)leaving the tissues, like the muscles. Please help

Biology
Please fill in the blanks : Proteins _____make up the _______ materials , hormones , and enzymes in living things to function correctly .

Biology
6. Consider an experiment in which starch is dissolved in a liter of water. Some of the solution is placed into a securely tied dialysis bag. The dialysis bag is placed into a beaker containing distilled water and iodine for 30 minutes. What are the correct answers for the ...

Maths
In a class of 60students,the number of student passed Biology is 6 more than the number of student passed Chemistry,8 student passed both subject.How many student passed Biology,how many student passed Chemistry,how many student passed only one subject?

biology ms sue
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought* c. after a volcanic eruption, global avarage temperatures lower d. the snow ...

biology
which of the following is an example of human-caused durbance to an ecosystem a. a tsunmi destroys a coastal forest and causes flooding b. a river is diverted to irrigate farmlands during a drought c. after a volcanic eruption, global avarage temperatures lower*** d. the snow ...

Biology
Why does humans perceive a red dress as the color red? A- The molecules of the dress do not absorb red light wavelengths B- The molecules of the dress absorb green and blue light wave lengths C- A red dress will primarily absorb red light wave length D A red dress will not ...

Biology
Light absorption by a pigment is measured for red, blue, green, and yellow light.

Biology
What is the energy of helium in its second excited state

biology
is c2h5 polar or non polar?

Biology
Explain the structure of a water molecule and how hydrogen bonding leads to some of its very special properties. Be sure to include how these properties are important to life on Earth

maths
In a class of 60 students, the number of students who passed biology is 6 more than the number who passed chemistry. Every student passed at least one of the two subjects and 8 students passed both subjects. I) how many students passed biology? ii) how many students passed ...

maths
In a class of 80 students, 53 study Art, 60 study Biology, 36 study Art and Biology, 34 study Art and Chemistry, 6 study Biology only and 18 study Biology but not Chemistry. Illustrate the information on a Venn diagram. Determine the number of students who study (I) Arts only...

biology/science
Oxygen attracts electrons more strongly than hydrogen does. What kind of bond forms between the two hydrogen atoms and single oxygen atom that form a water molecule? A. A metallic bond B. A hydrogen bond C. An ionic bond D. A polar bond Currently stuck here.

Biology
I would like some help if that is OK, like soon!:) 1.) A group of scientists proposes an idea that a chemical compound will enable bean plants to grow faster. They grow one group of bean plants in the presence of the compound and another group in the absence of the compound. ...

Biology
You begin with 10 ml of 2% acetic acid, and you add 90 ml of water. We will call the resulting solution "dilution#1". What is its concentration? You then repeat the dilution exactly, using 10ml of Dilution #1, adding 90 ml of water. We will call the resulting solution "...

Biology
three similar celery stalks are placed in solution of dye for 5 mins to examine diffusion in living cells. what are some possible sources of error? suggest improvements to the experimental design?

stats
Jason, a freshman at a local college, just completed 15 credit hours. His grade report is presented below. Course: Calculus, Biology, English, Music, P.E. Credit Hours 5, 4, 3, 2, 1 Grades C, A, D, B, A The local university uses a 4 point grading system, i.e., A = 4, B = 3, C...

Biology
A farmer sets up a buffalo farm in this ecosystem. Over time, the buffalo greatly reduce the grass biomass in the community. Explain how the introduction of this new species could affect the amount of energy transferred within the food chain.

Biology
why is protein folding important to enzyme activity?

Biology
why is protein folding important to enzyme activity?

Biology
why is protein folding important to enzyme activity?

biology
Both of the following processes represent what? A. A baker using yeast to make dough rise. B. Inserting human insulin genes into bacteria to make insulin for diabetics. biotechnology transgenic organisms genetic engineering all of the above

Cell Biology Help Please!
1) AMP -activated protein kinase (AMPK): Option A: is activated by both AMP and ADP. Option B: undergoes allosteric regulation. Option C: all of the choices are correct. Option D: adds phosphate groups to serines and threonines in other enzymes. 2) Which of the following ...

Biology
Which one of the following is NOT blood parasite? (A)plasmodium(B)trypanosoma(C)trichinell​a(D)L.donovani

biology
Which of the following is the definition of ecology? -the social movement with a goal to protect the environment -the recycling of human-made materials to reduce the waste going into landfills -the study of interactions among organisms and between organisms and their ...

Biology
Jacobie wanted to test the projectile motion of a pumpkin. His hypothesis was "if the pumpkin had a larger mass, then the higher he could throw it, because the larder pumpkins would have more force." He bought three orange pumpkins and test them all on the same day. His ...

physics
How do the laws of physics apply to others sciences such as biology chemistry and earth science? And give an example to show the connection.

9th Grade Biology
You set up 5 samples that contained a range of sucrase concentrations but the same amount of substrate (sucrose). - The pH was kept constant in all tubes buy using the same amount of buffer. - The temperature was kept constant in all tubes (room temp) - A negative control was...

9th Grade Biology
Sometimes, a new experimental result may seem to go against a well-established scientific theory. Often, such results seem like they are the results of researcher error. Regardless, scientists cannot just ignore new findings that disagree with accepted ideas. Which statement ...

9th Grade Biology
Cell theory is based on a series of discoveries. In 1655, Robert Hooke coined the word "cell" from his investigations of cork cells. Almost two hundred years later, Schleiden and Schwann proposed the cell theory that states that: All life forms are made from one or more cells...

Biology
What are the examples for dehydration synthesis and hydrolysis?

biology
1. Suppose you plant a seed and observe that a tree of large mass grows from it. The tree achieves a final mass that changes very little for years afterward. Which of the following is true about the tree? (1 point) Both anabolic and catabolic reactions took place in the seed ...

general biology
Describe how an organism broken down into smaller components?

biology
which of the following is consistent with the theory of vitalism ? A.all matter contains a vital force** b.the chemistry of life and nonlife are similar c. living things contain a vital force absent in nonliving things d. life must be sustsained through a series of chemical ...

AP Biology
I have the compound C20H24O2N2, A quinine molecule The Question: Calculate the molarity of 100.7g of quinine in 275 mL of water.

AP Biology
I have the compound C30H62, the candle The question is: When a candle is burned, 150.0 liters of O2 (g) is used up. How many grams of oxygen react?

biology
explain the following statement: "life is complex on the molecular level"

Biology
Explain the following statement: "life is complex on a molecular level. How is your environment different from the biosphere?

Biology
A biology student is studying ways to grow crops in soils that are high in salts and other dissolved solids. To determine whether corn plants can tolerate salty soil conditions, she grows one corn plant in typical non-salty soil and one corn plant in the same soil plus 0.5 ...

Biology Vocab
This is an error in measurement that can be caused by an imperfection in the equipment being used or from mistakes the experimenter makes while taking the measurement.

Biology Vocab
This is the degree at which a test measures what it is intended to measure. It a Vocab word but im not sure which one. Please help ASAP

Biology
What is the sample size in this experiment? How can you tell what the sample size is in this case? A team of researchers observed that the acorn density of the oak forests in New York fluctuates from year to year and that mice populations in the forest were increased when the ...

Biology
The question is exactly like this: The nurse is reviewing a client's blood ph level. which of the systems in the body regulate blood Ph? select all that apply A.buffers b.respiratory c.renal d.cardiac

biology
Which organelle(s) are likely to be involved in the reduced efficiency of amino acid recycling in wimpys liver cells?

biology
Color blindness is a defect in vision of colors, this defect is due to a localize-homologous segment of chromosome X. In the document I have a pedigree which the parents and their children are normal; but then most of the children got married to a diseased one which 50% ...

biology
1. how does the density of ice compare to that liquid water and why is that property important to aquatic oranisms a. the density of ice is higher than that liquid water, which means that ice forms from the bottom of lakes upward , protecting aquatic life in waterI b. the ...

biology
1. how does the density of ice compare to that liquid water and why is that property important to aquatic oranisms a. the density of ice is higher than that liquid water, which means that ice forms from the bottom of lakes upward , protecting aquatic life in waterI*** b. the ...

biology
how do electrons move

biology
which of the following is not a characteristic of life A. maintains homeostasis B. composed of cells C. composed of atoms D. carries out metabolism which of the following must be true to consider something to be alive? A. it must be able to replicate it's DNA B. it must be ...

biology
which of the following is not a characteristic of life A. maintains homeostasis B. composed of cells C. composed of atoms D. carries out metabolism which of the following must be true to consider something to be alive? A. it must be able to replicate it's DNA B. it must be ...

biology
In a cross between a white-eyed female fruit fly and red-eyed male, what percent of the female offspring will have white eyes? (White eyes are X-linked, recessive)

biology
Could a man with type B blood and a woman with type AB blood produce a child with type O blood? Explain

biology
Albinism (lack of pigment) is caused by a recessive allele in humans. If normal parents have an albino child, what is the probability that their next child will be normal for pigment?

Biology
why is water vital to maintaining a constant internal environment? A. It is cohesive* B. It is adhesive C. It is a good solvent D. It has a high specific heat

Biology
How are cohesion and adhesion of water ar linked to photosynthesis

Biology
Which of the following properties of water would be most important in protecting a fish in a shallow pond on a hot summer day? A. the low density of water in the solid phase B. water's strong forces of adhesion C. the high specific heat of water D. water's solvent properties ...

biology
: How are cohesion and adhesion properties of water linked to photosynthesis

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>

Homework Help: Science

Post a New Question