
during the downpour in a village,the rainwater carried away excess of nitrogenous and other compounds present in the soil to a will they affect the growth of algae and phyloplankton in the pond?

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?

Diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct answer on its correct place.

In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11

Suppose that a repressor regulated the expression of the galA gene. Which of the parenthesis would be correct? (((supposing hypothetical bacterium gene: "galA" – encodes an enzyme that is required for cells to digest the sugar galactose/and/ "argB" – encodes an enzyme that...

Should the point (0,0) be plotted on this graph? Average Temperatures in Degrees F. (1)Jan 52 (2)Feb 57 (3)Mar 65 (4)Apr 73 (5)May 80 (6)June 87 (7)July 89 (8)Aug 88 (9)Sept 82 (10)Oct 73 (11)Nov 63 (12)Dec 55 This data represents a repeating cycle. Should the point (0,0) be ...

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy sequencing ...

If a microscope has a 40× objective lens in place and a 15× eyepiece lens, the magnification of the system under these conditions is

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTG​AAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValT​hrTyr)

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Which of the following is the purpose of the waxy substance that builds up in the ear canal? A. Insulating the ear canal B. Trapping and removing debris C. Promoting sound conduction D. Cushioning and stabilizing the pinna I thinks it is B

biology, molecular
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Which of the following will happen if mRNA fails to be translated? A The cell's nucleus will produce more chromatin. B. Ribosomes will not be able to create protein. C. Mitochondria will release ATP. D. The cell will produce more mRNA I think it's B

Which of the following classes of biomolecules are frequently responsible for bringing about cell differentiation? A Transcription factors B. lnterleukins C. Cytokines D. Nucleotidyl transferases I think it's A

Which of the following is the purpose of valves in the venous circulatory system? A. Promoting movement of oxygenated blood toward the heart B. Facilitating stasis of blood in the veins C. Propelling blood through the vena cava D. Preventing backward flow of deoxygenated blood...

In an experiment, a researcher counts the number of oxygen bubbles produced by water plants placed under different colors of light. The researcher finds that water plants placed under white light release more oxygen bubbles than water plants placed under red light. Which of ...

A researcher collects high-resolution photographs of the Earth taken from outer space at annual intervals for the last decade. This data would be most useful to analyze which of the following? A. Human movement during crises B. Migration patterns of large whales C. ...

Mutations during which of the following processes in animals will affect offspring of succeeding generations? A Meiosis B. Mitosis C. Translation D. Transcription I think A!

Biology/ a&p
Which of the following parts of the circulatory system carries oxygenated blood? A. An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...

Which of the following represents Boyle's gas law? A. Gas turns to a liquid when temperature reaches 0° C (32° F). B. As the volume of a gas increases, the temperature also increases. C. At any temperature, inert gases are less combustible than non-inert gases. D. At a fixed...

Which of the following processes produces haploid gametes? A. Meiosis B. Fertilization C. Mitosis D. Invagination I think A

6. If each of eight biology classrooms is in use for 5 hours and 15 minutes per day, and total of 84 student experiments are done, how long does each experiment take on average? A.20 minutes B.30 minutes C. 40 minutes D.50 minutes E.1 hour please show work.

1. Giraffes have long necks that allow them to reach more food sources in their habitat. The long neck trait is an example of A. selection. B. adaptation. C. radiation. D. homology. 2. Which of the following is the most common kind of chemical bond in biological molecules? A. ...

Is emulsification chemical or mechanical?

Which of the following is the balanced equation for photosynthesis in plant cells? A 3C0+ 3H0 + Energy --)-CH120 + 30 2 266 2 B. 6C0+ 6Hp + Energy--)-CHp + 60 2 616 2 C. CH0 + 30--)-3C0+ 3H0 + Energy 6126 2 2 2 D. CHp + 60--)-6C0+ 6Hp + Energy 616 2 2 I really do not know

. Which of the following parts of the circulatory system carries oxygenated blood? A An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...

. The covalent bonds between the monomers of an enzyme macromolecule are A. glycosidic bonds. B. peptide bonds. C. phosphodiester bonds. D. ester bonds. I thimk it is B

. Which of the following is the term given to the sequence of nucleotides that contains the information to make a specific protein molecule? A. Promoter B. Gene C. Operator D. Locus I thinh it is B.

Plant -+ Deer --+ Tiger The first step in the energy chain that created the bonds of proteins in the tiger's muscle cells in the food chain shown above is the A. deer the tiger ate. B. plant the deer ate. C. photons the sun made. D. carbohydrates the plant made. I think it is D.

Which of the following terms describes changes in allele frequencies in the gene pool over a single generation? A. Macroevolution B. Microevolution C. Segregation D. Speciation

. Which of the following is an appropriate description of the arrangement of the cell membrane? A. Fluid phospholipid bilayer containing embedded proteins B. Rigid carbohydrate bilayer containing embedded phospholipids C. Rigid layer of phospholipids with proteins on the outer...

You have discovered a new species of yeast and you would like to determine the pathway that this organism uses to synthesize the amino acid tryptophan. This yeast species can take up tryptophan, or synthesize it on its own if tryptophan is not present in the environment. ...

chemistry, biology
Calculate the pH of a solution obtained by adding 20 mL of .2M KOH to 480 mL to .02M isoelectric glycine

give an article of 100 words on cardiac attack

How animal cells compensate the function performed by vacuoles in plant?

Give an account of different components of nucleus and also mention their function?

Mention the role of DNA and RNA in living organisms?

Why do the primitive organisms have lesser number of cells as compared to more advanced forms?

Water boils at a higher temperture than a non-polar solvent like either because?

My textbook says human blood is cooled to 0 degree celsius before haemodialysis .I am wondering why?

does dark reaction helps in transmittance and conservation of energy

Today many different species of tortoise may be found in he Galapagos islands. Using your knowledge of evolution, explain how these many specues arose from one common ancestor?

Discuss the concept of species. What ways do modern taxonomists use to distinguish different species?

what does the following carry. 1.artery 2.vein 3.pulmonary artery. 4.pulmonary vein 5.right auricle 6.right ventricle. 7.left auricle 8.left ventricle

A bacterial strain divides once every 30 minutes. After 90 minutes, a single bacterium can form a total of ___ bacteria

What would happen if a nucleotide was deleted in the exon region of a gene? the intron?

What are the similarities between virus and retrovirus?

What are the similarities between capsid and prion?

What are the similarities between Prion and virus?

How much heat is needed to raise the temperature of 20g of copper from 20 degrees celcius to 40 degrees celcius? (The specific heat of copper is 385J/Kg degrees celcius)

if a population comprised 52 AA, 114 Aa and 34 aa individuals and the 'A' allele was dominant, what would be the genotype, allele, and phenotype frequencies be

biology Please Help
The probability that their baby will be a carrier of the gene for PKU is (A) __________. The probability that their baby will be affected by PKU is (B) __________. If both genotypes were Pp, the probability that their baby would be affected by PKU would be (C) _________. my ...

How does insulin and glycogen help maintain homeostasis in one's body ?

If two different people use the same dichotomous key to identify the same organism, should they have different results? Explain. ( 3 points ) I put: They should have the same results. Since they are using the same key, the results couldn't possibly change. Anything else I can ...

biology plz help
Holly knows from talking with Renee that genes control traits and are determined by the sequence of nucleotides. When that sequence of nucleotides is altered for some reason during DNA replication, it can lead to the gene being expressed in a different way or to a genetic ...

Simple Biology
A majority of scientists worldwide agree with a new theory of evolution proposed by a group of students. The theory will most likely be (2 points) rejected. accepted. non-testable. non-observable. *I think it is B, but I am not sure

biology honors
i am doing a research paper on animal rights what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "animals used as experiments") my thesis is animals should not be used as expirements. ...

Biology Please help
There are several genes that control eye color; eye color is therefore called a (A) Polygenic trait. Besides genes that directly control eye color, there are other genes that can affect the color of your eyes. For example, your eye color genes may code for green eyes, but if ...

biology honors
i am doing a research paper on cancer. what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "the good and bad of cancer"

Biology 30
In what size populations might you expect it to be relatively common for alleles to become fixed? Why? I think that larger populations would be more likely to have fixed alleles, since perfect Hardy-Weinberg equilibrium states that there will be no change in allele frequency ...

human biology
If type B blood was accidentally given to someone with Type O blood, a defense response called (A)__________ would occur. This is because the type O person has A and B defensive proteins called (B)__________ that would mount a defense against the type B blood, causing clumping.

Human immunodeficiency virus (HIV), the virus that causes AIDS, is unique because its main genetic instructions are in the form of RNA instead of DNA. Because of this, it’s called a(n) (A) __________. When a person is infected with HIV, the immune system mounts a normal ...

BIOLOGY please help
The first phase of somatic cell division is (A) __________, when the cell’s chromosomes condense, and the nuclear envelope that holds the chromosomes starts to break up. During this time, structures called the (B) __________ form from centrioles, which will attach to the ...

During exercise, (B) __________ muscles in the walls of the veins contract and cause the vein walls to stiffen so more blood flows to the heart and lungs.

Biology - Help!!
Can someone check these for me? 1. Excretion is the process of (1 point) exchanging carbon dioxide for oxygen. removing metabolic wastes from the body.*** pumping blood throughout the body to supply nutrients and oxygen to cells. breaking food down into nutrients that can be ...

What part absorbs light and converts it into nerve impulses What part bends light that enters the eye so that what you see is focused on your retina What part transfers the image the eye sees to the brain for perception

The hypothalamus secretes a hormone called GnRH that makes the anterior pituitary gland release FSH, referred to as (A)__________ hormone, and LH, or luteinizing hormone. As the levels of these two hormones increase, the oocyte and layer of cells that nourish it grow. As this ...

biology Help
The fertilized egg undergoes cell divisions that form a ball of cells during (A)__________. During (B)__________, the endoderm, ectoderm, and mesoderm form. All the tissues of the adult body will come from these three germ layers. Differentiation is the process where cells are...

biology help
The fertilized egg undergoes cell divisions that form a ball of cells during (A)__________. During (B)__________, the endoderm, ectoderm, and mesoderm form. All the tissues of the adult body will come from these three germ layers. Differentiation is the process where cells are...

biology help
The cells in the retina that detect color and bright light are called _________ cells.

suppose some natral disaster occured and a speices of finch is forced to relocate from its original island where it dined on cactus flowers to an adjacent island with many fewer cacti but an over abundance of orchids what would be the imediate consequences to the speices in ...

biology help
Frequent urination is associated with alcohol consumption because alcohol suppresses the hormone (A)__________. As a result, urine becomes more (B)__________, and the body loses more water than it should.

Which type of reproduction is associated with using the most necessary resources (e.g., the most nutrients or most energy)? - binary fission - asexual reproduction - sexual reproduction - budding

A strand of DNA contains the following bases. ATT CCG GGA TTT a) what amino acids are coded for? First of all, would the mRNA strand be UAA GGC CCU AAA?

Human Biology please help
components of sense and smell Olfactory receptors in the nose travel directly to the olfactory (A)__________ before arriving at the olfactory cortex in the frontal area of the brain. This part of the brain has a direct link with the amygdala, which is involved with emotion and...

Human Biology please help
Cross section of the brain Located in the forebrain, the (A)__________ is responsible for controlling homeostasis and making adjustments in how the organs work. While the rest of the brain is protected from viruses, bacteria, toxins, and hormones in the blood, this part of the...

Okay my question has to do with a pedigree shown in an illustration. Since I can't show the illustration I'll do my best to describe it: There's a mother and a father and they have 4 kids: 2 boys, 2 girls. Circles represent females and squares males. A darkened shape means the...

Proteins are manufactured through the "blueprints" found on DNA. After they are translated, they are moved through a system of internal membranes before being distributed throughout the rest of the cell. At some point in the process, they are modified to their functional form...

In snapdragon plants, neither one of the petal colors is dominant to the other. The hybrids have a intermediate phenotype. If a homozygous red flower is crossed with a homozygous white flower, What will the offspring’s phenotype be?_____________________________ (Use C for ...

A farmer sprays insecticide on his crops and notices that the insect pest problem disappears. A year later he tries the same insecticide only to find that he did not achieve the same result. The insect population shows resistance to the insecticide. This is an example of ____ ...

which of the following is not a part of the theory of evolution

Can we predict or show the outcome of monohybrid crosses for parents with different allele combinations?Explain your answer

Hydrolysis uses a catabolic reaction. Explain what a catabolic reaction is and how it is useful in creating monomers from polymers.

Describe how a monomer is the basic unit of all macromolecules.

Biology help please
1.Many freshwater invertebrates eliminate ammonia by: A. Converting it to uric acid and eliminating it with solid wastes. B. simple diffusion across the gill membranes. C. converting it to urea and eliminating it in their urine. D. simple diffusion across the skin.****** 2. ...

Biology help please
1.Many freshwater invertebrates eliminate ammonia by: A. Converting it to uric acid and eliminating it with solid wastes. B. simple diffusion across the gill membranes. C. converting it to urea and eliminating it in their urine. D. simple diffusion across the skin.****** 2. ...

9. The restriction endonuclease AluI leaves blunt ends on DNA fragments after digestion. These blunt ends a) form hydrogen bonds with the blunt ends of other fragments produced by AluI b) are fully base paired c) have only one unpaired base d) always include the base adenine e...

Biology PleaSE help!
Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...

5. Dideoxynucleosides are employed in the course of the Sanger process of DNA sequencing. Dideocynucleosides are used because a) They stop the synthesis of DNA strands b) They are fluoresce c) They are radioactive d) They move quicly during gel electrophoresis e) They ...

Biology help please
1.Many freshwater invertebrates eliminate ammonia by: A. Converting it to uric acid and eliminating it with solid wastes. B. simple diffusion across the gill membranes. C. converting it to urea and eliminating it in their urine. D. simple diffusion across the skin.****** 2. ...

Could anyone explain shade avoidance in auxin in plants?

Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...

Examining an animal showing juvenile somatic characteristics and sexual maturity, how can you tell if this is the result of progenesisor neoteny?

Identify the sentence that is correctly punctuated. A. Clara did not study very much for her biology test, therefore, she guessed at many of the answers. B. Clara did not study very much for her biology test; therefore she guessed at many of the answers. C. Clara did not study...

Identify the sentence that is correctly punctuated. A. Clara did not study very much for her biology test, therefore, she guessed at many of the answers. B. Clara did not study very much for her biology test; therefore she guessed at many of the answers. C. Clara did not study...

  1. Pages:
  2. <<Prev
  3. 7
  4. 8
  5. 9
  6. 10
  7. 11
  8. 12
  9. 13
  10. 14
  11. 15
  12. 16
  13. 17
  14. 18
  15. 19
  16. 20
  17. 21
  18. Next>>

Homework Help: Science