Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

SCIENCE:BIOLOGY>
1. How many seconds do you spend in school during the week (6.5 hours/day)? 2. How many micrograms are in 12 dekagrams? 3. How many centimeters are in 5 kilometers? 4. 3.25 liters are equal to how many kiloliters? 5. how man meters are in 0.65 hectometers? 6. How many grams ...

biology
Suppose that a person inherited an allele of HGD from their father that had the proline 230 to serine mutation and also inherited an allele of HGD from their mother that had the glutamic acid 42 to alanine mutation. What would be that individual’s phenotype? Choose the best...

biology
You have a stock solution that is 350g/L . You perform a 9-fold serial dilution four times. What concentrations will you have in each of your diluted tubes in g/L? (Separate your answers with a comma.)

Biology
PCSK9, a protease that regulates the level of LDL receptors, is a new target for lowering circulating levels of LDL. Excess PCSK9 leads to a decrease in LDL receptor levels. Which one of the following tools would you use in mice to model a potential therapy for humans with ...

Biology
What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...

Biology
What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...

Biology
In a controlled experiment, a scientist is studying how long it takes pea plants growing in different soil types to develop flower buds. What is the manipulated independent variable? a) type of soil used b) number of flower buds produced c) how long it takes for flower buds to...

Biology
Why are most factors held constant in a scientific experiment? Answer: the only part of an experiment that ever changes is the independent variable.

Biology
What is a written observation called? Answer: hypothesis

Biology
Is yeast living, nonliving, or dead? Explain why.

Biology
Compare and contrast the structure and function of a compound light microscope and a scanning electron microscope. Be sure to discuss the structure and function of each as well as the function and usefulness of each when examining a specimen. Please help! I just need help ...

Biology
How would you describe the role that observations and inferences play in the scientific process?

biology
anonyms

biology
Explain how both nucleic acids and proteins are polymers.Be sure to describe the monomers that make up the polymers.

biology
You want to design an experiment to test if a bacteria affects a transmembrane protein. What types of controls should you use to eliminate effects of confounding variables?

biology
Is this correct? 2 examples of reproduction is a starfish and a rose bush....

biology
What are two examples of cellular organization.. Plz help Google sucks 😂

Science
Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for his career? A.biomedical science and meteorology B.oceanography and paleontology C.chemistry and biology D.physics and computer science ...

Science
Which branches of science do pharmacists need knowledge of to do their job properly? A.physics and chemistry B.biology and chemistry C.chemistry and geology D.physics and computer science Is the answer B?

Biology
You are testing the injection of a new chemical on mice to see if it can shrink tumors. To properly administer the chemical, it must be dissolved in water with ascorbic acid (vitamin C) and injected into the middle of a tumor. As a positive control, you plan to similarly ...

Biology
While performing an experiment, a positive control group is given a treatment that was used one time previously in another experiment. This time, however, the positive control does not give the expected result that you received last time. Which of the following is a likely ...

Biology
You want to know if a new species of bacteria we identified (E. glados) has resistance to the antibiotic valinomycin. You make “plates” of LB-agar to culture bacteria on. Some of these are regular LB-agar plates that any bacteria will grow on and others have valinomycin in...

Biology
A "tree of life" explains: a. how organisms are related to each other b. how organisms differ from each other c. the lineages of various organisms. d. All of the above

Biology
Reptiles do not live in the Arctic; however, some birds do, even though they evolved from reptiles. In your own words, offer an explanation for this fact. Include information on the metabolic differences between the two groups' bodies, as well as what effect their metabolic ...

science(biology)
state three secondary functions of roots,stems and leaves

BIOLOGY
A reference calls for the use of "one litre of 0.1 molar acetate buffer pH 5.2” Calculate the amounts of sodium acetate and acetic acid required to make up this buffer, given that for acetic acid Ka = 1.8 x 10-5

biology
during the downpour in a village,the rainwater carried away excess of nitrogenous and other compounds present in the soil to a pond.how will they affect the growth of algae and phyloplankton in the pond?

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?

Biology
Diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct answer on its correct place.

math
In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11

Biology
Suppose that a repressor regulated the expression of the galA gene. Which of the parenthesis would be correct? (((supposing hypothetical bacterium gene: "galA" – encodes an enzyme that is required for cells to digest the sugar galactose/and/ "argB" – encodes an enzyme that...

Biology
Should the point (0,0) be plotted on this graph? Average Temperatures in Degrees F. (1)Jan 52 (2)Feb 57 (3)Mar 65 (4)Apr 73 (5)May 80 (6)June 87 (7)July 89 (8)Aug 88 (9)Sept 82 (10)Oct 73 (11)Nov 63 (12)Dec 55 This data represents a repeating cycle. Should the point (0,0) be ...

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy sequencing ...

biology
If a microscope has a 40× objective lens in place and a 15× eyepiece lens, the magnification of the system under these conditions is

biology
doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

science
doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 separate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...

biology
so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTG​AAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValT​hrTyr)

Biology
5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

Biology
5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and virtual lab made ...

Biology
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Biology/Help
Which of the following is the purpose of the waxy substance that builds up in the ear canal? A. Insulating the ear canal B. Trapping and removing debris C. Promoting sound conduction D. Cushioning and stabilizing the pinna I thinks it is B

biology, molecular
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACGGTG​GATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGCCAC​CTAGGTTCCG-5’ Tip: If ...

Biology
Which of the following will happen if mRNA fails to be translated? A The cell's nucleus will produce more chromatin. B. Ribosomes will not be able to create protein. C. Mitochondria will release ATP. D. The cell will produce more mRNA I think it's B

Biology
Which of the following classes of biomolecules are frequently responsible for bringing about cell differentiation? A Transcription factors B. lnterleukins C. Cytokines D. Nucleotidyl transferases I think it's A

Biology
Which of the following is the purpose of valves in the venous circulatory system? A. Promoting movement of oxygenated blood toward the heart B. Facilitating stasis of blood in the veins C. Propelling blood through the vena cava D. Preventing backward flow of deoxygenated blood...

Biology
In an experiment, a researcher counts the number of oxygen bubbles produced by water plants placed under different colors of light. The researcher finds that water plants placed under white light release more oxygen bubbles than water plants placed under red light. Which of ...

Biology
A researcher collects high-resolution photographs of the Earth taken from outer space at annual intervals for the last decade. This data would be most useful to analyze which of the following? A. Human movement during crises B. Migration patterns of large whales C. ...

Biology
Mutations during which of the following processes in animals will affect offspring of succeeding generations? A Meiosis B. Mitosis C. Translation D. Transcription I think A!

Biology/ a&p
Which of the following parts of the circulatory system carries oxygenated blood? A. An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...

Science/Biology/Physics
Which of the following represents Boyle's gas law? A. Gas turns to a liquid when temperature reaches 0° C (32° F). B. As the volume of a gas increases, the temperature also increases. C. At any temperature, inert gases are less combustible than non-inert gases. D. At a fixed...

Biology/Science
Which of the following processes produces haploid gametes? A. Meiosis B. Fertilization C. Mitosis D. Invagination I think A

math
6. If each of eight biology classrooms is in use for 5 hours and 15 minutes per day, and total of 84 student experiments are done, how long does each experiment take on average? A.20 minutes B.30 minutes C. 40 minutes D.50 minutes E.1 hour please show work.

Science/Biology/Physics
1. Giraffes have long necks that allow them to reach more food sources in their habitat. The long neck trait is an example of A. selection. B. adaptation. C. radiation. D. homology. 2. Which of the following is the most common kind of chemical bond in biological molecules? A. ...

Biology
Is emulsification chemical or mechanical?

Biology
Which of the following is the balanced equation for photosynthesis in plant cells? A 3C0+ 3H0 + Energy --)-CH120 + 30 2 266 2 B. 6C0+ 6Hp + Energy--)-CHp + 60 2 616 2 C. CH0 + 30--)-3C0+ 3H0 + Energy 6126 2 2 2 D. CHp + 60--)-6C0+ 6Hp + Energy 616 2 2 I really do not know

Biology
. Which of the following parts of the circulatory system carries oxygenated blood? A An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...

Biology
. The covalent bonds between the monomers of an enzyme macromolecule are A. glycosidic bonds. B. peptide bonds. C. phosphodiester bonds. D. ester bonds. I thimk it is B

Biology
. Which of the following is the term given to the sequence of nucleotides that contains the information to make a specific protein molecule? A. Promoter B. Gene C. Operator D. Locus I thinh it is B.

Biology
Plant -+ Deer --+ Tiger The first step in the energy chain that created the bonds of proteins in the tiger's muscle cells in the food chain shown above is the A. deer the tiger ate. B. plant the deer ate. C. photons the sun made. D. carbohydrates the plant made. I think it is D.

Biology
Which of the following terms describes changes in allele frequencies in the gene pool over a single generation? A. Macroevolution B. Microevolution C. Segregation D. Speciation

Biology
. Which of the following is an appropriate description of the arrangement of the cell membrane? A. Fluid phospholipid bilayer containing embedded proteins B. Rigid carbohydrate bilayer containing embedded phospholipids C. Rigid layer of phospholipids with proteins on the outer...

biology
You have discovered a new species of yeast and you would like to determine the pathway that this organism uses to synthesize the amino acid tryptophan. This yeast species can take up tryptophan, or synthesize it on its own if tryptophan is not present in the environment. ...

chemistry, biology
Calculate the pH of a solution obtained by adding 20 mL of .2M KOH to 480 mL to .02M isoelectric glycine

biology
give an article of 100 words on cardiac attack

Biology
How animal cells compensate the function performed by vacuoles in plant?

Biology
Give an account of different components of nucleus and also mention their function?

Biology
Mention the role of DNA and RNA in living organisms?

Biology
Why do the primitive organisms have lesser number of cells as compared to more advanced forms?

Biology
Water boils at a higher temperture than a non-polar solvent like either because?

biology
My textbook says human blood is cooled to 0 degree celsius before haemodialysis .I am wondering why?

biology
does dark reaction helps in transmittance and conservation of energy

Biology
Today many different species of tortoise may be found in he Galapagos islands. Using your knowledge of evolution, explain how these many specues arose from one common ancestor?

biology
Discuss the concept of species. What ways do modern taxonomists use to distinguish different species?

science:biology
what does the following carry. 1.artery 2.vein 3.pulmonary artery. 4.pulmonary vein 5.right auricle 6.right ventricle. 7.left auricle 8.left ventricle

biology
A bacterial strain divides once every 30 minutes. After 90 minutes, a single bacterium can form a total of ___ bacteria

Biology
What would happen if a nucleotide was deleted in the exon region of a gene? the intron?

Biology
What are the similarities between virus and retrovirus?

biology
What are the similarities between capsid and prion?

biology
What are the similarities between Prion and virus?

Biology
How much heat is needed to raise the temperature of 20g of copper from 20 degrees celcius to 40 degrees celcius? (The specific heat of copper is 385J/Kg degrees celcius)

biology
if a population comprised 52 AA, 114 Aa and 34 aa individuals and the 'A' allele was dominant, what would be the genotype, allele, and phenotype frequencies be

biology Please Help
The probability that their baby will be a carrier of the gene for PKU is (A) __________. The probability that their baby will be affected by PKU is (B) __________. If both genotypes were Pp, the probability that their baby would be affected by PKU would be (C) _________. my ...

biology
How does insulin and glycogen help maintain homeostasis in one's body ?

Biology
If two different people use the same dichotomous key to identify the same organism, should they have different results? Explain. ( 3 points ) I put: They should have the same results. Since they are using the same key, the results couldn't possibly change. Anything else I can ...

biology plz help
Holly knows from talking with Renee that genes control traits and are determined by the sequence of nucleotides. When that sequence of nucleotides is altered for some reason during DNA replication, it can lead to the gene being expressed in a different way or to a genetic ...

Simple Biology
A majority of scientists worldwide agree with a new theory of evolution proposed by a group of students. The theory will most likely be (2 points) rejected. accepted. non-testable. non-observable. *I think it is B, but I am not sure

biology honors
i am doing a research paper on animal rights what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "animals used as experiments") my thesis is animals should not be used as expirements. ...

Biology Please help
There are several genes that control eye color; eye color is therefore called a (A) Polygenic trait. Besides genes that directly control eye color, there are other genes that can affect the color of your eyes. For example, your eye color genes may code for green eyes, but if ...

biology honors
i am doing a research paper on cancer. what are some specific issues related to the topic and develop a specific research question from your selected contemporary issue. ( i put "the good and bad of cancer"

Biology 30
In what size populations might you expect it to be relatively common for alleles to become fixed? Why? I think that larger populations would be more likely to have fixed alleles, since perfect Hardy-Weinberg equilibrium states that there will be no change in allele frequency ...

human biology
If type B blood was accidentally given to someone with Type O blood, a defense response called (A)__________ would occur. This is because the type O person has A and B defensive proteins called (B)__________ that would mount a defense against the type B blood, causing clumping.

Biology
14. The layer of skin that contains nerves and blood vessels is the _________ 15. ________ digestion occurs in the small intestine through the action of enzymes. 16. Urea, excess water, and other waste materials are eliminated in a water fluid called ______________. 17. ...

biology
Human immunodeficiency virus (HIV), the virus that causes AIDS, is unique because its main genetic instructions are in the form of RNA instead of DNA. Because of this, it’s called a(n) (A) __________. When a person is infected with HIV, the immune system mounts a normal ...

BIOLOGY please help
The first phase of somatic cell division is (A) __________, when the cell’s chromosomes condense, and the nuclear envelope that holds the chromosomes starts to break up. During this time, structures called the (B) __________ form from centrioles, which will attach to the ...

Biology
During exercise, (B) __________ muscles in the walls of the veins contract and cause the vein walls to stiffen so more blood flows to the heart and lungs.

Biology - Help!!
Can someone check these for me? 1. Excretion is the process of (1 point) exchanging carbon dioxide for oxygen. removing metabolic wastes from the body.*** pumping blood throughout the body to supply nutrients and oxygen to cells. breaking food down into nutrients that can be ...

biology
What part absorbs light and converts it into nerve impulses What part bends light that enters the eye so that what you see is focused on your retina What part transfers the image the eye sees to the brain for perception

biology
The hypothalamus secretes a hormone called GnRH that makes the anterior pituitary gland release FSH, referred to as (A)__________ hormone, and LH, or luteinizing hormone. As the levels of these two hormones increase, the oocyte and layer of cells that nourish it grow. As this ...

biology Help
The fertilized egg undergoes cell divisions that form a ball of cells during (A)__________. During (B)__________, the endoderm, ectoderm, and mesoderm form. All the tissues of the adult body will come from these three germ layers. Differentiation is the process where cells are...

  1. Pages:
  2. <<Prev
  3. 5
  4. 6
  5. 7
  6. 8
  7. 9
  8. 10
  9. 11
  10. 12
  11. 13
  12. 14
  13. 15
  14. 16
  15. 17
  16. 18
  17. 19
  18. Next>>

Homework Help: Science

Post a New Question