Post a New Question

Homework Help: Science: Biology

Recent Homework Questions About Biology

biology
Which phases are exactly the same for both the Cell Cycle and Meiosis? Can someone please help me with this and explain this to me? Thank you :)

biology
Which phases are exactly the same for both the Cell Cycle and Meiosis? Can someone please help me with this and explain this to me? Thank you :)

Biology
Where does the carbon cycle end? My project asks this, but I can of no specific "ending."

Biology
How does oxygen move in a food chain? When one organism eats another, does the oxygen move from the tissues of the prey to the predator, or is it something different?

biology(really need help!)
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web Are there any ecological issues surrounding the lilac flower(e.g. are its populations decreasing, is it spreading uncontrollably..)

biology
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web Are there any ecological issues surrounding the lilac flower(e.g. are its populations decreasing, is it spreading uncontrollably..)

biology
What role does the lilac flower play in its natural ecosystem? What is its niche in the food web

Biology
In an ecosystem, when energy is given off as heat, does it change forms from chemical substances to heat? Or is it something different?

biology,chemistry,physics
the contact process prepares purest form of sulphuric acid 2so2+o2=2so3 calculate its kp if following concentrations are found at equilibrium so2=0.59,o2=0.05 and so3=0.259

biology
Explain how a new population might be formed

biology
what is the most accepted mechanism for evolution

biology
Explain how a scientist would use DNA or protien sequences taken from three different organisms to create a cladogram

biology
Explain how a scientist would use DNA or protien sequences taken from three different organisms to create a cladogram?

Biology
If there are two sets of 21 chromosomes in a rats lung cell, how many total chromosomes are there in a cell that undergoes mitosis? Answer: 42

Biology
The creation of sex cells occurs in meiosis. Explain what happens when a new organism is created and life begins. Answer: meiosis is a process of cell division that produces sex cells, or gametes. Gametes are reproductive cells such as the sperm and egg. As gametes are ...

Biology
Explain what happens at the first checkpoint If GO is prevented from occuring. Answer: these cells can be called back from the G0 phase to the cell cycle by external cues

Biology
If there are two sets of 21 chromosomes in a rat's lung cell, how many total chromosomes are there in a cell that undergoes mitosis? Answer: 42

Biology
Male donkeys have 62 chromosomes in an eye cell. How many chromosomes would be found in a female donkeys egg? Answer: 62 Normally, pigs have 38 chromosomes in each somatic cell. How many chromosomes are there in a cell that has gone through meiosis? Answer: 19 How many ...

Biology
Ferrets have 40 chromosomes in each heart cell. There are ___ chromosomes in each egg. Answer: 20 If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 Sheep have 27 chromosomes in each cell that had undergone meiosis. How ...

Biology
1. Ferrets have 40 chromosomes in each heart cell. There are ____ chromosomes in each egg. Answer: 20 2. If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 3. Sheep have 27 chromosomes in each cell that has undergone ...

biology
Explain parts of the stem structure in the lilac flower or a flower similar to the lilac flower

biology
I need help finding diagrams of the leaf structure, stem structure and root structure of a lilac flower with explanations. Sites would help

Biology
name three ways somatic cells are different from gamete cells. 1. Gametes are sex cells and are always haploid 2. Somatic cells are non sex cells 3. ?

Biology
explain what would happen if sperm and egg cells were accidentally diploid. If the gametes were not haploid, then the fertilized zygote would have four sets of chromosomes and would probablydie before birth.

Biology
Different types of plants may be angiosperms, vascular seed, vascular non-seed, or non-vascularplants 1) Short grass meadow----I def. know it's not an angiosperm but can it be vascular non-seed 2) Magwort---im debating if it's non-vascular 3) Chokeberry -- def not an ...

Biology quick question
What is the method of nitrogenous waste removal for the following & choose between ammonia, urea or uric acid Tunicates Fishes Amphibians Reptiles Birds Mammals I think tunicates are urea and fishes are ammonia? But please help because I'm not sure and I don't know the rest

Biology
"Emma has difficulty sleeping. Her doctor prescribes Deflex. Deflex is a drug which affects the nervous system. Suggest and explain how Deflex affects the nervous system to help Emma sleep." I have missed a lot of time off of school and I understand how the nervous system ...

Biology quick help
What is the method of nitrogenous waste removal for the following & choose between ammonia, urea or uric acid Tunicates Fishes Amphibians Reptiles Birds Mammals I think tunicates are urea and fishes are ammonia? But please help because I'm not sure and I don't know the rest

Biology
If all of our cells have the same DNA, how come all 23 of our chromosomes are shaped differently?

Biology
What can I write for an assignment that asks me to write about what ecology means to me? I don't know exactly what is meant by "means to you," as in the assignment.

biology
What are some benefits and challenges of being a pharmacologist?

biology
explain the vascular system in the lilac flower.

Biology
If 320 F2 offspring resulted from this F1 cross, how many would be green?

Biology
Based on cellular respiration, what happens when oxygen supply is cut off to an animal?

Biology
what is the vascular system of the lilac flower. i tried finding some sites. some sites would help me. PLease!

biology
Explain the vascular system of a lilac flower Some sites would help me very much as i cant find any that explain the vascular system of the lilac flower.

Biology
Pod color and pod shape were two other traits Mendel was interested in. Set up a dihybrid cross for these two traits. Note: Green pods are dominant over yellow pods and inflated pods are dominant over constricted pods. -Start off with both parents as heterozygotes/hybrids for...

Biology
How is ATP released as heat? Where does the heat go?

Chemical Biology
Which fruits or vegetables or plants do not contain catalase enzyme?

biology
Describe the vascular system and functions of each component of the Lilac flower i tried to find some sites, but i cant find in any. So any sites would help as well

biology
To find out which key will open a lock, you try several until one works. This kind of learning is called ________________________.

biology
phase in photosynthesis during which the energy in sunlight is trapped and converted into ATP and NADPH I need the term for this and cannot find it anywhere. Thanks!

AP Biology
The respiration of plants is a biochemical reaction and should have a rate determined by the Arrhenius equation, k = Ae-EA/RT. Here, k is the rate, A is a constant, EA is the activation energy for the reaction, R is the gas constant, and T is the temperature in kelvins. If the...

biology
which is true about the inside of a cell? -the inside of an animal cell contains structures that carry out specific jobs for the cell, but no water or molecules dissolved in water -the inside of an animal cell contains water, molecules dissolved in the water and structures ...

Biology
Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT​ CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...

Science
For my science (biology) coursework i am doing an experiment involving photosynthesis- the cabomba experiment. I need to know 1- the variables that are controlled and why 2- what equipment is used and why PLEASE HELP... THANK YOU

biology
Amoeba captures food with the help of

Biology
In humans, the allele for brown eyes is dominant to the allele for blue eyes. If a man with blue eyes and a woman with brown eyes who is homozygous for eye color have children, what is the probability of having a child with blue eyes? Here are the choices: 25 percent, 100 ...

Intro Biology
I can't find examples in the book as reference. Please help me with these questions and explain why. 1.) Which of the following has no vascular tissue (“plumbing system”)? A) Conifer B) Angiosperm C) Fern D) Moss E) Ginkgo 2.) Which of the following characteristics of ...

Biology
In what form of energy does energy from sunlight end up after photosynthesis and cell respiration?

Biology
What is this final stage of cellular respiration called where the most ATP molecules are made?

Biology
Discuss the common bacteria pathogens which are the most prevalent in causing disease in these three organs.

Life-Span Development
I need for someone to check my questions letters that I match up to the answers that I chose Here are the questions 1. Concrete Operational Stage (I chose d) 2.Egocentrism (I chose i) 3.Formal Operational Stage (I chose h) 4.Influences on the Development of Self Concept (I ...

Biology
I think this is a shot in the dark, but worth a try. I have the Biology: Life on Earth by Audesirk, Audesirk & Byers 10th edition bought used online, apparently there are some pages missing in the book, so I can't do my homework, if anyone has the book could, you help me by ...

biology
Are Lilac flowers vascular or non vascular

Biology
Would glucose be considered a reactant in glycolysis? Also, some sites are saying that 4 ADP molecules are also reactants, but I don't understand how?

Biology
How do the two ATP molecules charge the glucose molecule in glycolysis?

biology
the manufacturer of carbohydrates, fats, and proteins. whats the word to this definition?

biology
the release of waste into the enviroment. i need the word to this definition.

biology
the breakdown of food by enzymes. What is the word that goes with this definition?

Biology*STUCK*
A group of students was asked to list some of the similarities and differences between prokaryotic cells and eukaryotic cells. They created the table shown above. The students made a mistake in creating their table. Which statement best describes their mistake? a) Both ...

Biology
Is a Lilac Flower: a) Vascular or non-vascular b) Gymnosperm or angiosperm c) Monocot or a dicot My Work i know c) is dicot but i am not sure of the other two

Biology
Which alga is most closely related to plants? A) Chara B) Kelp C) Ulva D) Diatom E) Euglena I think it's chara, because it is green algae, but I'm not sure. Can you explain to me why it is or not?

ap biology
The best conclusion concerning delta is that the cells a. contain no DNA. b. contain no RNA. c. contain only one chromosome that is very short d. are actually in the G0 phase e. divide in the G1phase Explain your choice: Would it be d?

biology
cystic fibrosis is caused by a recessive allele. A child has cystic fibrosis, even though neither of his parents has cystic fibrosis. If this couple has another child, what is the probability he or she will NOT have cystic fibrosis ?

Biology *CHECK PLEASE*?
Signals that help the body process and respond to information from the environment are ________________. active transport nerve impulses equilibrium Is it Active transport ?

Biology*STUCK*
The fluid mosaic model describes the structure of the plasma membrane. Embedded within the plasma membrane are proteins and carbohydrates that contribute to the term mosaic. Glycolipids and glycoproteins are examples of carbohydrates on the surface of red blood cells that ...

Biology*STUCK*
The fluid mosaic model describes the structure of the plasma membrane. Embedded within the plasma membrane are proteins and carbohydrates that contribute to the term mosaic. Glycolipids and glycoproteins are examples of carbohydrates on the surface of red blood cells that ...

biology
if a color blind woman marries a man with normal vision,how do you set up punnett square?

Biology
When the CO2 concentration in the cells of a C3 plant is low compared with the O2 concentration, an enzyme combines RuBP with O2 rather than with CO2. What effect would this enzymatic change have on photosynthesis? Under what environmental conditions would it be more likely to...

biology
biolgist concludes that a molecule moves across cell membrane by facilitated diffusion because the molecule is small, polar and can accumulate inside cells even when its concentration inside the cell initially is higher that it is outside the cell and they use up more energy ...

biology
1. What allows a cell to stockpile substances in greater concentration than they occur outside the cell? is it active transport? 2. The sodium potassium pump prevents the accumulation of what ions inside the cell? 3. Conduction of nerve impulses is possible because of what? ...

biology
need help few questions 1. a signaling cell produces a signal that is detected by what type of cell? 2. If the interior of a typical cell is negatively charged, what type of charged ions will not require energy to diffuse into the cell using an ion channel? 3. Receptor ...

Biology
What is the relationship between the major body systems; Coordination systems through Homeostasis

biology
Various forms of a trait may be more or less ________ under given environmental conditions.

biology
Colour blindness is a recessive disorder. If a colour blind male is crossed with a normal female, what are the possible genotypes and phenotypes of the offspring

Biology
What are the macromolecules DNA and RNA referred to as? Proteins Carbohydrates Nucleic acids

biology
What does the word cycle tell you about the chemical reactions of the Calvin cycle?

biology
which of the following types of cells need to make energy to perform basic functions like growing, moving, and reproducing? -animal cells -animal cells and bacteria cells -animal cells, bacteria cells, and plant cells -plant cells

biology/cells
what cells can make energy from sugar molecules? -only plant and animal cells -only animal cells -plant, animal, bacteria, and protist cells -only plant cells

Biology
The scientist analyzes the insulin molecules, which are proteins, of three different species, A, B, and C. The insulin from A is different from B in six ways and from C in three ways. The insulin from B is different from C in two ways. Which two species appear to be most ...

Biology
Please Give 10 statements to prove that plants can reproduce sexually.

can someone help me with biology
please

BIology
please answer mine ms sue if you can. if not, can you please say you cant

Please help
can you please look at Tevon Pitts's Biology Question please

Biology
What is the advantage of highly folded membranes in a cell? Name an organelle that uses this strategy?

Biology
What is the advantage of highly folded membranes in a cell? Name an organelle that uses this strategy.

biology
dont even know where to start You prepared a 10-fold dilution of a culture out to 10-9. You initially estimated there were between 3 x 108 cells/ml and 5 x 109 cells/ml in the original cell suspension. Which tube dilutions would you plate to ensure you captured significant ...

biology
You carried out a 10-fold dilution series. You started with tube 0 which contained an overnight culture of E. coli. You estimated the original culture contained 6 x 108 cell/ml using McFarland nephlemeter standards. You plated 0.1 ml volumes of a number of the dilutions. Which...

Biology
Compare ad contrast indirect versus direct values of biodiversity and provide two examples?

biology
what is contracting subunit of skeletal muscle called

Biology
1. Mitochondria and chloroplasts reproduce the same way free-living bacteria do—by _____________. My answer: Binary fission. 2. The tropism that allows seedlings to find their way out of the soil and into the sunlight is _________________. My answer: Positive tropism.   3. ...

biology
Which characteristic of life is maintaining a stable internal environment. A)Reproducing B)Homeostasis C)Growing and developing D)Responding to stimuli

biology
why meiosis is named as meiosis 1and2?

PSYCH/SOCIOLOGY!!!
Should I take psychology before sociology or take sociology before psychology. Like saying "You can't do well in chemistry unless you finish biology"

BIOLOGY
Which of the following is/are true about where electrons end up? The last molecule of the ETC in the mitochondrian donates electrons to water and releases oxygen The last molecule of the ETC in the mitochondrion donates electrons to oxygen and makes water NADH and FADH2 ...

BIOLOGY
Fermentation: (Select all that are true) Uses pyruvate to accept electrons Uses pyruvate to donate electrons Regenerates NADH Regenerates NAD+ Directly makes ATP Allows glycolysis to continue in the cytoplasm making ATP Allows oxidative phosphorylation to continue int he ...

Biology
A couple has a child with an autosomal recessive form of glycogen storage disease, a deficiency of a lysosomal enzyme. An enlarged liver and heart and weak muscles cause the baby to die from heart and lung failure at 20 months. Now the woman is pregnant again. Her doctor ...

Biology
Why is it important that cells produced after meiosis be diverse? My answer: Meiosis is involved it the formation of gametes, so if the cells produces were not different, then everyone would be identical. Is this correct? @Mrs. Sue? someone? Thank you! :)

Biology
Why can the identity of a compound not be determined by cutting out the spot on an autoradiogram and subjecting it to chemical analysis?

  1. Pages:
  2. <<Prev
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. Next>>

Homework Help: Science

Post a New Question