7th grade science bobpursley

5.
Change in the hereditary features of a type of organism over time is ______. (1 point)

growth
biogenesis
spontaneous generation
evolution

10.
Gregor Mendel discovered some alleles can cover up the presence of others; these alleles are called __________. (1 point)

My answers:
5. evolution
10. dominant

  1. 👍 0
  2. 👎 0
  3. 👁 74
  1. Go to the head of the class. All correct.

    1. 👍 0
    2. 👎 0
  2. please don't put a particular teacher's name in the subject box. What happens often, if that teacher is not online, other teachers don't look at it, and you MISS OUT on help.

    Thanks.

    1. 👍 0
    2. 👎 0
  3. Okay I will! Thanks!

    1. 👍 0
    2. 👎 0
    posted by Delilah

Respond to this Question

First Name

Your Response

Similar Questions

  1. 7th grade science

    1. How many chromosomes do human sex cells have? (1 point) 22 43 46 23 2. The actual genetic makeup of an organism for a particular trait is called the ______. The physical characteristic that trait gives the organisms is called

    asked by Delilah on January 16, 2013
  2. 7th grade science ASAP

    1. How many chromosomes do human sex cells have? (1 point) 22 43 46 23 2. The actual genetic makeup of an organism for a particular trait is called the ______. The physical characteristic that trait gives the organisms is called

    asked by Delilah on January 16, 2013
  3. Plz check

    1. Blood type in humans is controlled by ____ alleles with an additional Rh factor that determines _________ . one; color two; positive or negative charge three; shape of blood cells four; phenotype 2. If two people are

    asked by Help on December 15, 2016
  4. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  5. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  6. Science

    In witch type of symbiotic relationship is one organism helped while another organism is neither benefited nor harmed?

    asked by Rebecca on February 26, 2019
  7. Math help

    In which type of symbiotic relationship is one organism helped while another organism is neither benefitted nor harmed? A: Mutualism B: Predation C: Commensalism D: Parasitism

    asked by Katy on February 20, 2019
  8. SCIENCE TEST HELP ME?

    12. ______ are the basic units of structure and function in living things (1 point) 13. A(n) ______ is a group of similar cells that perform a specific function in an organism. (1 point) 14. ______ are nerve cells that carry

    asked by moof on February 11, 2019
  9. biology

    Which of the following are NOT used to classify kingdoms of organisms? a. complexity of the organism b. invertebrate or vertebrate c. method of obtaining nutrition d. type of cell that makes up the organism D?

    asked by Pamela on May 7, 2010
  10. spanish

    Yo ______ lavo ______ manos y ______ cara. ______ cepillo ______ dientes y ______ cepillo ______ pelo. Yo ______ pongo ______ ropa.

    asked by jack on March 25, 2012

More Similar Questions