A and P

The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
What is its mRNA nucleotide sequence?

Indicate the product of this DNA segment/gene.
What is the product’s primary structure?
How many peptide bonds are in the product?

  1. 👍 0
  2. 👎 0
  3. 👁 180
  1. You might try some of the links in the following search BUT next time please identify the School Subject so that it is recognizable to all the volunteer teachers! A and P is a grocery store to me!

    http://search.yahoo.com/search?fr=mcafee&p=how+to+find+the+mRNA+nucleotide+sequence+of+a+strand+of+DNA

    Sra

    1. 👍 0
    2. 👎 0

Respond to this Question

First Name

Your Response

Similar Questions

  1. biology

    1. Chromosomes and genes share all of the following characteristics except that Possible Answers A. they both undergo segregation during meiosis. B. they are both present in pairs in all diploid cells. C. they are both copied

    asked by Evan on June 23, 2008
  2. BIOLOGY

    Describe the processes of transcription and translation and correctly identify the anticodon for the following DNA template strand-ACG TGG GCA TGA ACG TGG. Which amino acids do these anticodon represent?

    asked by NAN on July 26, 2012
  3. Biology

    http://talk.collegeconfidential.com/showthread.php?p=4515174 Imagine you had made an RNA copy of each strand of a DNA double helix. If you were now to mix these two RNA single-strand copies together, do you think they would form a

    asked by bobpursley on August 5, 2007
  4. Physics

    Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's

    asked by Eman on October 12, 2011
  5. Biology

    What 3' to 5' DNA sequence would correspond to a 5'-AUG-3' start codon?

    asked by Danielle on March 22, 2014
  1. ap biology

    The first step in making a protein is transcription of a gene. This occurs in the 1._______of a eukaryotic cell. An enzyme called 2.______ carrres out the process of transcribing RNA from the DNA. It starts at a specific

    asked by Cici on January 4, 2012
  2. Science

    I answered the questions, but I don't know if my choices are right. 1) Which of the following is an acidic pH? 6 7 8 800 None of the Above Answer: 6 ------------------------------------- 2) Which of the following is directly

    asked by Jane on March 21, 2015
  3. biology

    1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds

    asked by Anonymous on February 24, 2008
  4. genetics

    What is a replication bubble? A.A complex of replication enzymes on the DNA template strand B.A DNA sequence that initiates replication C.A tangle of denatured DNA strands near the replication fork D.A locally denatured segment of

    asked by Lucy on March 22, 2015
  5. biology

    6) If the DNA sequence is GTAC, what will be the mRNA sequence? a) CATG b) CTUT c) CAUG d) UCGG 7) Given the codon UGC, what will be its anticodon? a) ACG b) TCG c) TGC d) AAT

    asked by mark on December 6, 2011
  6. Biology

    I need some help with these questions. I've chosen answers, but I want to make sure if they are correct. 1)Which of the following is an acidic pH? 6 7 8 800 A: 6 None of the above ------------------------------------- 2) Which of

    asked by Krista on March 20, 2015

You can view more similar questions or ask a new question.