Login or Sign Up

Ask a New Question

DNA transcription and translation

Questions (14)

The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 1 answer
2. asked by Sonya
3. 498 views
Three-letter segments of mRNA code for specific(1 point)Responses sickle cells. sickle cells. amino acids. amino acids.
1. 1 answer
2. asked by Daphne
3. 45 views
Question 8During mRNA transcription, a DNA strand has the bases CTAGGT. What is the complementary strand of mRNA?
1. 1 answer
2. asked anonymously
3. 130 views
Complete the mRNA sequence that will be formed from the DNA sequence below, then identify the amino acids using the codon chart
1. 1 answer
2. asked anonymously
3. 194 views
Completethe mRNA sequence that will be formed from the DNA sequence below, then identify the amino acids using the codon chart
1. 4 answers
2. asked by PAtato
3. 99 views
Complete the mRNA sequence that will be formed from the DNA sequence below, then identify the amino acids using the codon chart
1. 1 answer
2. asked by cool
3. 100 views
This is an mRNA sequence for the name of a protein found throughout your body:5' C U A C C U C A G A U U C G C C U A C C U 3'
1. 2 answers
2. asked by Keisha
3. 511 views
Question 1This question REPLACES the Unit 6 Lesson 9 discussion. This is worth 4 points of your total weekly recap quiz. Please
1. 1 answer
2. asked anonymously
3. 36 views
This question REPLACES the Unit 6 Lesson 9 discussion.This is worth 4 points of your total weekly recap quiz. Please do your
1. 1 answer
2. asked anonymously
3. 32 views
During mRNA transcription, a DNA strand has the bases CTAGGT. What is the complementary strand of mRNA?DtmpOP_634d3d8f27d6f.gif
1. 1 answer
2. asked anonymously
3. 20 views
What would happen if a cell transcribed and translated a gene’s intron by mistake?(1 point)Responses The DNA would remain the
1. 1 answer
2. asked anonymously
3. 9 views
Select ALL the correct answers.An mRNA codon chart is shown below. Suppose a DNA triplet has the sequence 3′-ATG-5′. Which
1. 1 answer
2. asked anonymously
3. 21 views
When a cell needs a particular protein synthesized, messenger RNA (mRNA) is produced from DNA through transcription.How is
1. 1 answer
2. asked anonymously
3. 15 views
During transcription the DNA base sequence is transcribed into a complimentary mRNA sequence. A codon table like the one shown
1. 1 answer
2. asked by o
3. 30 views