Biology

In class I had to make an organism and explain how it adapts to it's imaginary environment. We have to explain the amount of food of eats everyday too. my teacher said that Theres a 10% rule to follow but I don't know what it is. Can u help? Do you know the 10% rule that helps balance out an ecosystem?

  1. 👍 0
  2. 👎 0
  3. 👁 97

Respond to this Question

First Name

Your Response

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?? a- a fourth organism

    asked by megan on February 23, 2008
  2. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  3. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008
  4. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  5. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  6. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  7. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  8. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  9. 10th grade biology

    you find an unusual organism growing on the bark of a dying tree . Under a microscope , you observe the cells are eukaryotic , have cell walls , and do not contain chloroplasts . Into what kingdom . Would you place this organism ?

    asked by shayla on June 3, 2009
  10. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism?

    asked by Tara on March 8, 2011

More Similar Questions