English

1. She admitted that she had made a mistake.

2. She admitted making a mistake.
-----------------------
Are both the same in meaning?

  1. 👍
  2. 👎
  3. 👁
  1. Yes, both mean the same, and both are grammatically correct.

    1. 👍
    2. 👎
    👤
    Writeacher

Respond to this Question

First Name

Your Response

Similar Questions

  1. Algebra

    a student's work to solve 2 6/7 divided by 2/7 is shown below. which of the following statements do you agree with? 2 6/7 divided by 2/7 = 19/7 divided by 2/7= 7/19 times 2/7= 7/19 times 2/7=2/19 cross out the 7 in the first one

  2. English

    1. He admitted breaking the window. 2. He admitted having broken the window. 3. He broke the window before, and he admitted it later. (Does #1 mean #2? Are they the same in meaning? Do #1 and #2 mean #3?)

  3. Math word problem

    The admission fee at an amusement park is $ 1.50 for children and $ 4.00 for adults. On a certain day, 258 people entered the park, and the admission fees collected totaled $712 . How many children and how many adults were

  4. English

    4) 1 The first rugs were made as a part of their need. Read the passage. Look at the underlined section marked number 1. There may be a mistake in the way the sentence is written. If you find a mistake, choose the answer that

  1. English

    1. He admitted cheating on the test. 2. He admitted that he had cheated on the test. 3. He admitted that he cheated on the test. (Does #1 mnean #2 or #3?) 4. I'll admit cheating on the test. 5. I'll admit that I cheat on the test.

  2. reading

    Now Annie was in bed, groaning theatrically—she’s a drama major—but I told my mother I’d go anyway. I hadn’t seen my grandmother since she’d been admitted to Lawnrest. (1 point) "I hadn't seen my grandmother" "she's a

  3. English

    1. He admitted cheating on the test. 2. He admitted that he cheated on the test. 3. He admitted that he had cheated on the test. cf. He admitted having cheated on the test. (Does #1 mean #2 or #3?) 4. He admits cheating on the

  4. Social Studies

    What was the mistake British General Charles Cornwallis made that ultimately caused his defeat?

  1. math

    Omar wanted to know if x−5 is a factor of the polynomial p(x)=x3−6x2−x+30. He applied the Factor Theorem and concluded that x−5 is a factor of p(x), as shown in the following work. Step 1: p(5)=53−6(52)−5+30 Step 2:

  2. Algebra

    review the problem that george worked on he was simplifying an expression but made a mistake working on the following problem what mistake did he make when applying the steps of pemdas, 8 ÷ 2³ - 16 ÷ 2 4³ - 16 ÷ 2 64 - 16 ÷

  3. mRNA

    sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino

  4. English

    Which sentence combines these two sentences and includes a relative clause? The twins pretended to be each other. The switch was a huge mistake. Choices The twins pretended to be each other, which was a huge mistake. The twins

You can view more similar questions or ask a new question.