Science

posted by .

an idea that is based on many detailed observations

_ _ E _ _ _


a part of an organism that can be used for identification

_ _ _ _ _ _ _ R _

  • Science (Partial) -

    Theory

    I don't know the second one. I was thinking genotype/genome or fingerprint, but those don't fit.

  • Science -

    Do your homework,stupid.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  2. Science Fossils

    When might preserved remains of an entire organism form?
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  4. Science

    When evolution was first proposed, which of the following was used as evidence to support the idea?
  5. Science

    Which statement is true of an organ system?
  6. Science

    When evolution was first proposed, which of the following was used as evidence to support the idea?
  7. Ms. Sue PLZ HELP!!!(science)

    When evolution was first proposed, which of the following was used as evidence to support the idea?
  8. Science

    1.) when might preserved remains of an entire organism form?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Business

    If an in-court identification is influenced by an out-of-court identification, it is called a(n): a. tainted identification. b.flawed identification. c.unreliable identification. d.improper identification.

More Similar Questions