Post a New Question

Genetics

posted by .

The following DNA segment has one ORF. Do you know what it codes for?

5'-TAGGATGTTCGACATGTAAGCTT

ATCCTACAAGCTGTACATTCGAA

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

More Related Questions

Post a New Question