Genetics

posted by .

The following DNA segment has one ORF. Do you know what it codes for?

5'-TAGGATGTTCGACATGTAAGCTT

ATCCTACAAGCTGTACATTCGAA

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Genetics

    A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA?
  2. science (Genetics and Evolution)

    What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?
  3. science

    A segment of double-stranded DNA contains 31% Adenine (A) bases. a. What are the percentages of the other three bases in the DNA segment?
  4. Biology

    The production of a polypeptide involves the correct sequencing of amino acids, originally encoded by a segment of DNA. This code is transcribed onto mRNA and subsequently translated using tRNA. From the following DNA segment, record …
  5. Science

    How does DNA determine a trait such as eye color?
  6. genetics

    DNA is often purified by DNA electrophoresis, like in old-school DNA sequencing. In DNA electrophoresis, fragment separation is based on _____. (Best answer) A.fragment charge. B.fragment size. C.fragment sequence. D.fragment G-C content. …
  7. genetics

    DNA markers, or variant non-coding regions of DNA, are DNA polymorphisms that are useful for genetic mapping. True False
  8. genetics

    What is a replication bubble? A.A complex of replication enzymes on the DNA template strand B.A DNA sequence that initiates replication C.A tangle of denatured DNA strands near the replication fork D.A locally denatured segment of
  9. genetics

    Though this question sucks, which enzyme elongates the new DNA strand starting at an RNA primer?
  10. Genetics

    The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix?

More Similar Questions