Post a New Question

Math

posted by .

the concentration of a certain substance in our organism is given by the model Q9t) = Q(subscript 0) e^-0.1960t

a) what quantity of substance is present in the organism of this individual 3 hours after ingestion?

b) after how many hours will there only be 10% of this substance ingested by the individual?

  • Math -

    Q(t) = Q0 e^-0.1960t
    where t=elapsed time in hours (Check, not mentioned in the question).
    So after three hours,
    Q(3) = Q0 e^(-0.1960*3)=?

    Q(t) = 0.9Q0
    or
    e^(-0.1960t)=0.9
    Take natural log:
    -0.1960t = ln(0.9)
    t=ln(0.9)/(-0.1960)=?

    I'll leave it to you to work on your calculator.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  2. chemistry

    In a chemical reaction, substance A combines with substance B to form substance Y. At the start of the reaction, the quantity of A present is a grams, and the quantity of B present is b grams. Assume a> and <img src=. At time …
  3. Calculus

    In a chemical reaction, substance A combines with substance B to form subtance Y. At the start of the reaction, the quantity of A present is a grams, and the quantity of B present is b grams. Assume a is less than b. At time t seconds …
  4. chemistry

    The initial concentration of the a substance was 1.95 M. After 27.72 hours the concentration was 0.9750 M. After anothers 55.44 hours the concentration was 0.4875 M (total time = 83.16 hours). If another experiment were conducted in …
  5. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  6. Pre-calculus

    Initially 600 milligrams of a radioactive substance was present. After 7 hours the mass had decreased by 3%. Construct an exponential model A(t) = A0ekt for the amount remaining of the decaying substance after t hours. Find the amount …
  7. Calculus

    The amount remaining of a radioactive substance after t hours is given by A(t) = 100ekt. After 12 hours, the initial amount has decreased by 4%. How much remains after 48 hours?
  8. Math

    Suppose f(t) = P0e^-0.3t grams of radioactive substance are present after t seconds. If 200 grams of substance are present initially, how much is present after 4 seconds?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Math

    A radioactive substance decays to the formula N=8e^-0.6t , where N is the number of milligrams present after t hours. Determine the initial amount of the substance to the nearest 10th of an hour, determine the half life of the substance, …

More Similar Questions

Post a New Question