Post a New Question

Biology

posted by .

how does the external environment of an organism can affect gene function.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. biology

    When genetically engineering an organism, a plasmid a. is the main chromosome of the bacteria that is cloned. b. is cut with a restriction enzyme to accept the gene of interest. c. helps screen for cells that did not take up the gene …
  2. bio

    Discuss how the external environment of an organism can affect gene function.
  3. Biology

    An organism has three independently assorting traits AaBbCc. What fraction of its gametes will contain the recessive gene abc?
  4. biology

    an organism's reaction to a change in its intenal or external enviroment
  5. Biology

    The shrunken gene of wheat encodes a large enzyme that converts glucose to starch in its grains. How would insertion of a 1 kb transposon into codon 23 of this gene affect the protein produced from this allele?
  6. biology

    Organisms must be able to adapt to a changing external and internal environment. An organism's ability to maintain a stable internal environment is known as homeostasis. How does a cell's membrane help an organism maintain homeostasis?
  7. biology

    identify and describe how organism could respond to an external stimulus
  8. Biology

    What would most likely happen to cells placed in fresh water?
  9. Biology Help Please!

    1) A transcriptional fusion of regulatory sequences of a particular gene with a reporter gene results in relatively uniform expression of the reporter gene in all cells of an organism, whereas a translational fusion with the same gene …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question