science

posted by .

i have a lots of question but my first onee is:whats a plant eater a meat eater what is an organism that causes anither organism to decay and my last what is what is an plant and a meat eater

  • science -

    Look up in a dictionary:

    carnivore, omnivore, herbivore

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. science

    would a plant be considered a cell and an organism?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. Math

    Steven bought a piece of meat and cut it into three pieces. The mass of the first piece of meat was 5/8 of the mass of the second piece of meat. The mass of the second piece of meat was 4/7 of the mass of the third piece of meat. a. …
  4. Science Fossils

    When might preserved remains of an entire organism form?
  5. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  6. Science

    1.) when might preserved remains of an entire organism form?
  7. Science

    If you find a mysterious organism, how can you figure out whether or not it is a plant?
  8. Science

    If you find a mysterious organism, how can you figure out whether or not it is a plant?
  9. 4th grade math

    Ryan is making small meat loaves. Each small meat loaf uses 3/4 pound of meat. How much meat does Ryan need to make 8 small meat loaves
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions