Post a New Question

5th grade

posted by .

A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.

  • Science, not "5th grade" -

    Assistance needed.

    Please type your subject in the School Subject box. Any other words, including obscure abbreviations, are likely to delay responses from a teacher who knows that subject well.

  • 5th grade -

    six legs: insect
    no backbone: inveterate

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. BIOLOGY

    IS A PLANT CELL AN EXAMPLE OF A UNICELLULAR ORGANISM?
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. 5th grade Science

    Why does a multicellular organism need specialized cells and why their apperances are different?
  4. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  5. Science

    A new organism is found that is multicellular, does not have a backbone and has six legs. Classfy this organism in two ways.
  6. biology

    Which of the following are NOT used to classify kingdoms of organisms?
  7. Science

    A new organism is found that is multicellular, does not have a backbone, and has six legs. How would you classify this organism?
  8. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism?
  9. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question