biology

posted by .

Parasites are dependent on their hosts for survival. Which organism do you think is better adapted to a parasitic lifestyle, one that is virulent and often kills its host, or one that only causes mild chronic illness in its host?

  • biology -

    Wouldn't it depend on some other factors? Such as
    the ability of the parasite to reproduce?
    the ability of the parasite to shift to various hosts (such as sheep, humans, and pigs, and chickens)?
    The ability of the parasite to mutate
    The ability of the parasite to resist treatment?
    The ability of the parasite to live in its host for a long period of time before it kills. see http://www.canismajor.com/dog/hartworm.html

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Permutations

    I am having trouble with this maths problem: There are 8 people at a round table - 6 guests, 2 hosts. How many possible arrangements are there if the 2 hosts aren't allowed to sit next to each other. Thanks hint: sit the two host first, …
  2. bio

    Scientists often want to know if the genetically transformed organism can pass its new traits on to its offspring and future generations. To get this information, which would be a better candidate for your investigation, an organism …
  3. Biology

    41. A group calling itself "Virus Alive!" believes that viruses are living organisms. They have petitioned the scientific community to include viruses in the biological classification system. You are a scientist assigned to explain …
  4. Biology

    Which of the following would increase the chance of a successful infection?
  5. help please

    What are eating disorders? A. An illness that leads to starvation B. An illness that causes serious disturbances to a person’s everyday diet C. An illness that causes little disturbance to a person’s everyday diet D. An illness
  6. Health

    What are eating disorders? A. An illness that causes serious disturbances to a person’s everyday diet B. An illness that leads to binging C. An illness that causes little disturbance to a person’s everyday diet D. An illness that
  7. Science

    Which statement is true of an organ system?
  8. Health

    What are eating disorders? A. An illness that causes little disturbance to a person’s everyday diet B. An illness that causes serious disturbances to a person’s everyday diet C. An illness that leads to starvation D. An illness
  9. science plz help fast

    how do mutualism and parasitism compare ?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions