Health/ Basic Clinical Procedures

Please check my answer thanks

An organism that can exist only in the presence of oxygen ?

A. anaerobic
B. oxygenopyhile
C. aerobic
D. heterotopy

I think it is C

  1. 👍 0
  2. 👎 0
  3. 👁 69
asked by Helana
  1. Right.

  2. you are correct.

    1. 👍 0
    2. 👎 0
    posted by Sigurd

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water? i guess what i am really asking is does the

    asked by lisa on October 18, 2009
  2. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?

    asked by sammi on October 17, 2009
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  4. Science! Biology 1

    Question: Which of following best describes the free-energy requirements of an organism? Answer Choices: During times of hibernation large amounts of free energy are required. Free-energy demand is consistent for all heterotrophs.

    asked by Carmen on November 14, 2013
  5. english/biology

    I was wondering if you can check to see if these are good predications, hypothesis and questions. Like does the grammar makes and stuff. Thank you Hypothesis : Temperature as one, environmental factor will affect the physiological

    asked by sam on February 2, 2011
  6. Earth science

    What prevents life from developing on land before Earth’s atmosphere contained a significant portion of oxygen? (1) All land locations were too hot for life to exist. (2) All terrestrial environments were too cold for life to

    asked by KaiCaster on December 9, 2015
  7. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  8. biology

    Does the affinity of myoglobin for oxygen change when oxygen concentration changes? Im not really sure how to answer this. I know that myoglobin has very strong affinity for oxygen so once myoglobin is in the presence of oxygen it

    asked by sean on October 7, 2018
  9. BIOLOGY

    Human tissue cells seem to fit together like pieces of a jigsaw puzzle. How is this arrangement of cells helpful to an organism? The presence of membranes around organelles indicates increasing complexity. Why do you think the

    asked by Kelly on October 6, 2009
  10. science

    ogranelle that modifies,packages and transport material out of the cell describes an organism that can exist onlly as a group of cells one of the structures a cell uses t o live ,grow and reproduce Ruth, Shondra, Jimmy -- We do

    asked by ruth on August 19, 2007

More Similar Questions