7th grade science ~ FOR MS. SUE

Are plants organism?


Please help!!
Thank you!!

asked by saranghae12
  1. Yes.

    posted by Ms. Sue
  2. Oh okay. Thank you!!! :)

    posted by saranghae12
  3. You're welcome.

    posted by Ms. Sue

Respond to this Question

First Name

Your Response

Similar Questions

  1. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26
  2. BIOLOGY

    IS A PLANT CELL AN EXAMPLE OF A UNICELLULAR ORGANISM? iS AN ANT AN EXAMPLE OF MULTICELLULAR ORGANISM? What are Plants Plants are multicellular photosynthetic organisms that are believed to have evolved from green algae. Both
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The
  4. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC
  5. Biology

    6. In a mycorrhizal relationship, what benefit does the plant get from the fungus? A. Energy Source B. Aid in seed dispersal<--(my answer, not to sure about it though...) C. Products of photosynthesis D. Aid in absorption of
  6. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it
  7. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace
  8. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace
  9. science

    Which term does not describe one of the three categories into which land plants are classified? Seedless vascular plants. Nonvascular plants. Flowering plants. Seed plants.
  10. Bio

    Which term does not describe one of the three categories into which land plants are classified? Seedless vascular plants. Nonvascular plants. Flowering plants. Seed plants.

More Similar Questions