ecology

If you were trying to decide if an unknown organism is an archaebacterium or an eubactrium, you woul look at the ribosomes because?

  1. 👍 0
  2. 👎 0
  3. 👁 77
  1. Try some of the following links:

    http://search.yahoo.com/search?fr=mcafee&p=why+would+you+look+at+the+ribosomes+to+decide+of+an+organism+is+an+archaebacterium+or+an+eubactrium

    Sra

    1. 👍 0
    2. 👎 0
  2. if you were decide if an unknown organism is an archaebacterium or aeubacterium you wold look at the ribosomrs brcause

    1. 👍 0
    2. 👎 0
    posted by sammy

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  2. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  4. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  5. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  6. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  7. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008
  8. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?

    asked by sammi on October 17, 2009
  9. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?? a- a fourth organism

    asked by megan on February 23, 2008
  10. biology

    1. name an organism in which the respiratory and circulatory systems are separate. 2. name an organism with a closed circulatory system that is not used for gas exchange. 3. name an organism whose waste gases accumulate in one

    asked by Marina on November 25, 2009

More Similar Questions