Biology

The human gene for the production of lactose is on chromosome 2. The dna nucleotide sequence of a small part from the middle is 123456789
TACTCGGAA
I haVeTO WRITe DOWN THE EQVIVALENT SEQUENCE FOR MRNA AND HENCE WORK out the sequence of amino acids coded in this part of the polypeptide produced

I get AUGAGCCUU
AUG = METHIONNNE
AGC= SER
CUU= LECINE
is this correct and would you be able to critique this for me


thanks

i have the same oh the Methionine is MET it is a start of the structure

check page 127 as seems your on the ou

  1. 👍 0
  2. 👎 0
  3. 👁 80
asked by Bex

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of

    asked by mysterychicken on February 3, 2010
  2. Biology

    pair up your nucleoide sequence with the mRNA sequence then you will find from the amino acids in the codons what amino acids are present in the lactase production. Each dna sequence coincincids with the appropriate mRNA sequence

    asked by Anonymous on April 7, 2007
  3. Biology PleaSE help!

    Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology

    asked by Deepa on May 8, 2014
  4. biology

    DNA codes for mRNA, which is then translated into polypeptides,which are strands of amino acids. The DNA sequence below codes for the following amino acids: methionine-valine-glycine-alanine-alanine-serine TAC CAA CCA CGC CGC UCA

    asked by stacey on December 31, 2007
  5. Biology

    Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology

    asked by Deepa on May 8, 2014
  6. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of

    asked by mysterychicken on February 3, 2010
  7. Science

    The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), write out the

    asked by HomeworkHatesMe on March 7, 2012
  8. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines

    asked by mysterychicken on February 8, 2010
  9. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines

    asked by mysterychicken on February 8, 2010
  10. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene.

    asked by Sonya on June 10, 2011

More Similar Questions