Biology

Which organism is a third-order heterotroph? To what trophic level does that organism belong?

  1. 👍 0
  2. 👎 0
  3. 👁 32
asked by Becky
  1. There are three types of heterotroph. One was eaten by the bible. Forget about it. The other three makes cupcakes with chef Boyardee.

    No but seriously, i believe its an old, old, wooden ship used in the civil war era.

    1. 👍 0
    2. 👎 0
    posted by John Hansen
  2. oh ya i heard that too

    1. 👍 0
    2. 👎 0
    posted by Dustin Soyring
  3. who is using my mane bra

    1. 👍 0
    2. 👎 0
    posted by ?????
  4. mi nombre esta dom y mi legusta chicos y pene

    1. 👍 0
    2. 👎 0
    posted by dom peterson
  5. jkjk lol lmao

    1. 👍 0
    2. 👎 0
    posted by idk
  6. YOU PEOPLE NEED TO STOP JOKING AROUND ABOUT SCIENCE....IT IS VERY IMPORTANT
    ! ESPECIALLY IF YOU WANT TO BE A SCIENTIST LIKE ME


    MUAH!

    1. 👍 0
    2. 👎 0
    posted by ScIeNcE nErD:)

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  2. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  4. Environmental Science

    7. Which of the following terms is used to describe a linear sequence in which energy is transferred from one organism to the next as each organism eats another organism? a. trophic level b. food web c. energy pyramid d. food

    asked by mysterychicken on April 15, 2012
  5. Environmental Science

    7. Which of the following terms is used to describe a linear sequence in which energy is transferred from one organism to the next as each organism eats another organism? a. trophic level b. food web c. energy pyramid d. food

    asked by mysterychicken on April 15, 2012
  6. Environmental Science

    What organism is likely to be in the bottom trophic level of a food chain? Single Celled of some kind depending on the environment.

    asked by Qiayamah on December 22, 2006
  7. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  8. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  9. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  10. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008

More Similar Questions