science

posted by Angelina

A new organism is introduced into a ecosystem. it gets its nutrients from a dead tree. can this organism be described as a scavenger or decomposer

  1. DrBob222

    I would think a dead tree was already decomposed (at least parts of it are decomposed) so this organism must be a scavenger.

Respond to this Question

First Name

Your Answer

Similar Questions

  1. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. Science

    1. In most organisms, what kind of organisms are producers plants 2. What benefit do decomposers provide for an ecosystem?
  4. Science

    1. In most organisms, what kind of organisms are producers Answer:plants 2. What benefit do decomposers provide for an ecosystem?
  5. Science Fossils

    When might preserved remains of an entire organism form?
  6. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  7. Science

    How does eye location beast represent the relationship between sturcture and function?
  8. Science

    List these from broadest to specific Organism Ecosystem Population Community Where would ecosystem fall Population, community, organism
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions