biology

posted by .

What is the sequence of the stop codon?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biochem

    The mRNA sequence of nucleotides for gene "Y" has been determined to be AGCCAUGCCCGCGAGGUAGAAA. You have decided to mutate the gene, such that a new and functional protein is expressed from this gene. To do this, you have placed the …
  2. Genetics

    if a start codon changes into a stop codon, how would this effect transcription?
  3. Biology

    Convert the following DNA sequence into its RNA equivalent and then using the genetic code, convert that RNA sequence into the amino acid sequence. 5’–TACTTCTTCAAGACT-3’ For this above DNA sequence, what information …
  4. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=?
  5. biology

    6) If the DNA sequence is GTAC, what will be the mRNA sequence?
  6. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=?
  7. biology

    The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine …
  8. Biology

    What 3' to 5' DNA sequence would correspond to a 5'-AUG-3' start codon?
  9. micro202

    Would someone help me with the following...it's not A.Thnx!! What would happen if the mRNA codon that coded for Cys was mutated in the third position from a U to an A?
  10. Biology

    During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodon binds to the messenger RNA codon. b. the transfer RNA anticodon binds …

More Similar Questions