bioloy

posted by .

Which fraction of the genome contains the most information? Explain.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. ap biology again

    In order to answer a question I must use this information but I find it very confusing. The restriction enzymes of bacteria protect the bacteria from succesful attack by bacteriophages, whose genomes can be degraded by the restriction …
  2. biology

    My teacher asked quite a few questions, but these are the ones with which I am having trouble...I have re-worded them somewhat for clarity. Can anyone please help me! Thank you! _____________________________________ Methotrexate is …
  3. biology

    You have isolated the genome from a novel virus and would like to determine its composition. you have three tubes, each containing one of these substance: 1. a protein that degrades double stranded DNA (DNase, tube 1) 2. a protein …
  4. information literacy

    explain the difference between primary sources of information and secondary sources of information.Identify which would be more helpful to you if you were looking for information concerning the animals that are used for detecting drugs …
  5. Genetics

    Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.
  6. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all …
  7. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  8. psychology

    i need 2 examples of what researchers on the human genome project have already learned a bout the human genome
  9. biology

    A bacterium has a genome size of 6.0 X 106 base pairs. There is one Origin of Replication (ORI) and each DNA polymerase catalyzes the addition of 1,000 nucleotides/second. How much time is needed to replicate the entire genome?
  10. Biology

    Why can viruses of the family of the Poxviridae be genetically modified more easily than viruses of most other viral families?

More Similar Questions