BIOLOGY

posted by .

WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    1. How many base pairs are in a full turn or twist of a DNA molecule?
  2. biology

    how do cells use the base sequence of a DNA molecule to produce a polypeptide?
  3. Biology

    Which of the following must occur for a mismatch error to be repaired?
  4. Biology-Is my answer correct

    Which of the following must occur for a mismatch error to be repaired?
  5. biology

    1) What is the complementary strand of the DNA sequence GCAAT?
  6. Biology

    For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'
  7. biology

    1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine …
  8. biology

    1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine …
  9. Biology (check answer)

    Transcription is similar to DNA replication in all of the following ways except: a) the DNA strands unzip b) the polymerase enzyme is involved c) complementary bases are paired up d) a new strand of mRNA is built from the existing …
  10. Chemistry

    The complementary base sequence in the RNA bound to a DNA strand with the base sequence shown below would be ____________________. -C-C-G-A-T-T- A) -G-G-C-T-A-A- B) -A-A-U-C-G-G- C) -C-C-G-A-T-T- D) -G-G-C-U-A-A-

More Similar Questions