science -Do you think DNA from another organism wo

posted by .

Do you think DNA from another organism would have a different appearance?

i m assuming yes.. is it??

  • science -Do you think DNA from another organism wo -

    Unless it is a twin or a clone of the same species, yes.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio...DNA

    Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism?
  2. Biology

    how can traits determine the characteristics of an organism?
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. science

    Which of the following must occur for a mismatch error to be repaired?
  5. Science

    mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right?
  6. science

    (a) Investigators often remove blood from a crime scene in order to extract DNA for forensics. Although blood cells do contain nucleic acids, why would blood yield relatively less DNA than semen containing sperm cells?
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Science

    How do you think a scientist might figure out a person’s identity from bones?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct …

More Similar Questions