Post a New Question

biology

posted by .

A eukaryotic gene typically has all of the following features except:
a) an operator
b) control elements
c) a promoter
d) introns
e) a terminator

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. biology

    relative to the transcription start site, where would the promoter and terminator be located?
  2. Science

    The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), write out the nucleotide …
  3. biology 2 ap

    All living organisms share all of the following features in common except A. carry out metabolism B. transfer energy with ATP C. encode hereditary information in DNA D. are composed of one or more cells E. containing organelles
  4. biology

    Can someone help? I don't understand gene regulation. The regulation of protein synthesis in cells involves the coordination of several different mechanisms. Discuss TWO of the specific mechanisms of gene regulation in eukaryotic cells
  5. Biology

    . Which of the following is the term given to the sequence of nucleotides that contains the information to make a specific protein molecule?
  6. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  7. Biology

    I need some help with these questions. I've chosen answers, but I want to make sure if they are correct. 1)Which of the following is an acidic pH?
  8. Biology

    How are the following terms related to the process of transcription and one another?
  9. Biology

    How do mutations that alter the nucleotide sequence of a promoter influence the original function of that promoter and thus the entire cell?
  10. Biology Help Please!

    )Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations …

More Similar Questions

Post a New Question