organism physiology paper

posted by .

explain how an organism has evolved physiologically to become suited to its environments. give examples.

  • organism physiology paper -

    explain how an organism has evolved physiologically to become suited to its environments. give examples.

  • organism physiology paper -

    Which organism have you chosen?

  • organism physiology paper -

    the human body

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. bilogy

    Organism Physiology Paper
  5. college

    explain how the organism in a diagram has evolved physiologically to become suited to its environeme
  6. bio 101

    how the organism in the diagram has evolved physiologically to become suited to its environmen
  7. biology

    explain how organisims have evolved physiologically to become suited to its environment
  8. Biology

    Locate a diagram of an organism with the main organs and structures labeled. Locate a diagram of an organism with the main organs and structures labeled. Briefly explain how the organism in the diagram has evolved physiologically to …
  9. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions