biology

posted by .

Which of the following are NOT used to classify kingdoms of organisms?

a. complexity of the organism

b. invertebrate or vertebrate

c. method of obtaining nutrition

d. type of cell that makes up the organism

D?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. biology

    1. name an organism in which the respiratory and circulatory systems are separate. 2. name an organism with a closed circulatory system that is not used for gas exchange. 3. name an organism whose waste gases accumulate in one system …
  4. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism?
  5. biology

    Organisms must be able to adapt to a changing external and internal environment. An organism's ability to maintain a stable internal environment is known as homeostasis. How does a cell's membrane help an organism maintain homeostasis?
  6. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  7. Science

    Which of the following shows the levels of organization in a multi-cell organism from the smallest level to the largest level?
  8. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  9. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct …
  10. Biology

    Hi! I'd love some clarification on this question Which of the following are NOT used to classify kingdoms of organisms?

More Similar Questions