Science

posted by .

A new organism is found that is multicellular, does not have a backbone and has six legs. Classfy this organism in two ways.

  • Science -

    What do you call organisms without backbones? What organisms have six legs?

    Look up "without backbone" and "six legs" on Google.

    In the future, you can find the information you desire more quickly, if you use appropriate key words to do your own search. Also see http://hanlib.sou.edu/searchtools/.

    I hope this helps.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. BIOLOGY

    IS A PLANT CELL AN EXAMPLE OF A UNICELLULAR ORGANISM?
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. 5th grade

    A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.
  5. Science

    A new organism is found that is multicellular, does not have a backbone, and has six legs. How would you classify this organism?
  6. Science Fossils

    When might preserved remains of an entire organism form?
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Science

    How does eye location beast represent the relationship between sturcture and function?
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions