Biology

posted by .

What are two different ways that genes are identified in prokaryotic versus eukaryotic genomes.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio 157

    I need to describe prokaryotic and eukaryotic chromosomes. I think I got prokaryotic the circular DNA molecule of prokaryotic organisms, containing the majority of the genes for the cell. I can't seem to define eukaryotic can u help?
  2. AP Biology

    discuss the characteristics that make up mammalian genomes larger than prokaryotic genomes
  3. Biology

    Using Darwin’s Theory of Evolution, describe how Eukaryotic cells could have developed from Prokaryotic cells. What advantages would the Eukaryotic cells have over the Prokaryotic?
  4. biology

    List 2 ways in which prokaryotic and eukaryotic cells are alike and 2 ways in which they are different. Is this correct?
  5. biology

    List 2 ways in which prokaryotic and eukaryotic cells are alike and 2 ways in which they are different. Is this correct?
  6. biology

    Which of the follow comparisons would be an inaccurate analogy between prokaryotic cells and eukaryotic cells?
  7. science

    Which of the follow comparisons would be an inaccurate analogy between prokaryotic cells and eukaryotic cells?
  8. Biology*STUCK*

    A group of students was asked to list some of the similarities and differences between prokaryotic cells and eukaryotic cells. They created the table shown above. The students made a mistake in creating their table. Which statement …
  9. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  10. Biology

    List 3 differences between eukaryotic and prokaryotic genomes. Describe how one of these differences might impact laboratory applications. What are two issues that might arise when genetically engineering a prokaryotic cell to express …

More Similar Questions