Biology

posted by .

2. The advantages of vascular tissue over nonvascular tissue are evident in
a. whether organisms have alternation of generations
b. an organism's size and complexity
c. the number of individual offspring produced by each organism
d. all of the above
B?

3. The typical vascular plant sporophyte
a. includes the developing embryo
b. has roots, shoots, and meistems
c. has specialized tissues that develop into conducting vessels
d. both b and c
D?

5. More than 70 percent of the world's cultivated farmland is used for growing __________ rich in _______________.
a. fruits; carbohydrates and fiber
b. roots; starch
c. grains; carbohydrates and fiber
d. legumes; protein
Not sure...

Thanks
-MC

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Grade 8 SCIENCE

    1. How is the vascular tissue in the stem different from the vascular tissue in the root?
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. Biology

    2. The advantages of vascular tissue over nonvascular tissue are evident in a. whether organisms have alternation of generations b. an organism's size and complexity c. the number of individual offspring produced by each organism d. …
  5. biology

    Which of the following are NOT used to classify kingdoms of organisms?
  6. Biology

    Which of the following is correctly matched with its tissue system?
  7. Science

    Which of the following shows the levels of organization in a multi-cell organism from the smallest level to the largest level?
  8. biology

    The (**) are my answers Which of the following is not a characteristic of life?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Biology

    Hi! I'd love some clarification on this question Which of the following are NOT used to classify kingdoms of organisms?

More Similar Questions