Post a New Question

science

posted by .

If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. science

    are the cells of a many celled organism more or less effiecient than a one-celled organism and why
  2. 10th grade

    A specific structure in a single-celled organism.How the structure is involved in the survival of the organism?
  3. science-biology help

    knowing that as the steepness of a concentration graident increases, the rate of diffusion increases, explain how a single celled organisms would respond in an oxygen rich pond compared to an oxygen poor pond. I'm not really sure but …
  4. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  5. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  6. Science Fossils

    When might preserved remains of an entire organism form?
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Science

    How does eye location beast represent the relationship between sturcture and function?
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question