biology

posted by .

The energy an organism requires to transport materials and eliminate wastes is obtained directly from.

  • biology -

    It's obtained directly from ATP adenosine triphosphate

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Transport Through the Cell Membrane Type of Transport Requires Name of Transport Protein Used Energy Transp- Input from ort Cell?
  2. Biolody

    Which of the following is NOT a characteristic of the respiratory surface of the alveoli?
  3. y no one anwering my ques

    How does active transport differ from passive transport?
  4. biology urgent

    Glucose is transported into a cell through a process of co-transport, where it is moved against its concentration gradient through a membrane channel. Moving any molecule against its concentration gradient requires energy, but these …
  5. Science! Biology 1

    Question: Which of following best describes the free-energy requirements of an organism?
  6. help i have no idea!!!!!!

    i need help To go out on a date Jason takes $65. The first hour he wastes $9, the second he wastes $12, the third he wastes $17. The last three hours he wastes no money. Create a graph showing this scenario.
  7. help i have no idea!!!!!!

    To go out on a date Jason takes $65. The first hour he wastes $9, the second he wastes $12, the third he wastes $17. The last three hours he wastes no money.
  8. science

    what is the way that an organism either builds up or breaks down materials in the body for energy
  9. Biology

    Which of the following is a NOT function of a vacuole?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions