Biology

posted by .

Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change? Thanks!

  • Biology -

    See the site in my response to a similar question posted just above this. The evolutionary mechanism is cited as the reason.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Convert the following DNA sequence into its RNA equivalent and then using the genetic code, convert that RNA sequence into the amino acid sequence. 5’–TACTTCTTCAAGACT-3’ For this above DNA sequence, what information …
  2. Biology

    Part 1: Genetics – From Genes to Proteins, Mutations (Chapter 10) Overview: Genetic information in DNA is transcribed to RNA and then translated into the amino acid sequence of a Protein. A) Step 1 - Transcription: During the process …
  3. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g …
  4. Math

    I'm learning series and sequences (grade 11). Please check that my steps show I understand what I'm doing/the concept and my answer as well: 5. The consecutive terms of an arithmetic sequences are 3.6, y, 8.2. Find the value of y. …
  5. Maths

    Eric thinks of 2 sequences.One is geometric and the other arithmetic.Both sequences start with the number 3.The common ratio of the geometric sequence is the same as the common difference of the arithmetic sequence.If the 6-th term …
  6. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all …
  7. Biology

    why do we use protein sequences when comparing genetic similarities?
  8. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. I don't get this math!

    Sequences that increase at increasing rates are sometimes described as “growing exponentially”. However, this is not always a correct use of the word. For example, both quadratic (constant second difference) and exponential growth …

More Similar Questions