BIOOOOO

posted by .

can somebody please explain the relationship between
the structure of DNA, protein
structure and the phenotype of an
organism and

the relationship between DNA chromatin and chromosome

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio...DNA

    Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism?
  2. Biology DNA

    can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
  3. Genes

    Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome …
  4. AP Biology- Molecular Genetics

    The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at …
  5. Biochemisty

    The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in …
  6. Science

    How does a mutation in the DNA affect the way proteins are made?
  7. Science

    How does a mutation in the DNA affect the way proteins are made?
  8. Science

    Genes are specific sections of (Fill in the blank) Answer choices alleles, chromosome, incomplete dominance, mitosis, codominance, centromere, DNA, diploid, reproduce, phenotype, meiosis, RNA Is the answer chromosome, or DNA?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Science HELP PLS

    1. What is a Genetic Mutation? A. the process of decreasing chromosome numbers to half of what the parent cell has B. the copying of DNA to form identical daughter cells C. a permanent change in an organism’s genetic code D. a fusion

More Similar Questions