
Newest questions and responses by stephanie
  1. Chemistry

    So I was asked to write the overall equation for Br2 in Dichloromethane with Cyclohexene. I can kinda fudge the overall reaction because I know the general reaction of halogens with a double bond, but I am wondering why is the Br2 in the Dichloromethane in

    asked on March 3, 2019
  2. Math

    Find the total tax deductions for each of the following weekly paychecks.weekly pay $98.00,$240.00,$150.00 FICA (7.65%)

    asked on January 15, 2019
  3. Physics

    First, I'm sorry for asking a lot of questions, however I don't know how to solve any of these problems. Can you please help me by telling me how I should solve it and what formulas should be used? I don't want the actual answers but how to solve these

    asked on December 9, 2018
  4. Science

    What does a warm front mean?

    asked on November 21, 2018
  5. Science

    What type of weather should the New England and area expect on Thursday and Friday?

    asked on November 21, 2018
  6. Science

    How does the convection of air produce thunderstorms?

    asked on November 21, 2018
  7. geography

    what city has the latitude of 51 26n and longitude of 5 30e

    asked on October 31, 2018
  8. English

    In not less than 350 word's write about Nigeria my county

    asked on October 1, 2018
  9. Math

    to celebrate the first day of a leap year, i taught my dog to jump through a hoop. it was a sunday. when he taught me the same trick the first day of the next year, it was a ? a. sunday b. monday c. tuesday d. wednesday is tuesday the correct answer?

    asked on August 6, 2018
  10. Math

    A plane left Atlanta at 11:30 AM and flew to an airport near Boston. The plane was due to arrive at 3:15 PM. The plane arrived 25 minutes late. The time of the trip was: Is the answer 4 hours and 10 minutes?

    asked on August 3, 2018
  11. math

    if a man travels r miles and hour for h hours and s miles an hour for t hours, what is his average rate in miles per hour for the ENTIRE distance traveled? a. rh+st b. r/h+s/t c. rh+st/2 d. rh+st/h+t is the answer b?

    asked on July 27, 2018
  12. Math 201

    I am having problems with this question in my math class. Consider a student loan of ​$25,000.00 at a fixed APR of 12% for 25 years. a. Calculate the monthly payment. The monthly payment is $263.31 b. Determine the total amount paid over the term of the

    asked on March 20, 2018
  13. Chemistry

    Calculate the relative effusion rate of hydrogen and oxygen, given that both the gases are diatomic, with hydrogen having a molar mass of 2 grams and oxygen having a molar mass of 32 grams. Using Graham’s law equation.

    asked on January 15, 2018
  14. Science

    What is the effect of hunting in the gender of species?

    asked on January 6, 2018
  15. physics

    What is the average useful power output of a person who does 5.50×106 J of useful work in 6.50 h? 235 W correct answer Working at this rate, how long will it take this person to lift 1850 kg of bricks 1.20 m to a platform? (Work done to lift his body can

    asked on December 6, 2017
  16. physics

    Calculate the force needed to bring a 1070–kg car to rest from a speed of 89.0 km/h in a distance of 110 m (a fairly typical distance for a non-panic stop). -2.97×103 N correct answer Suppose instead the car hits a concrete abutment at full speed and is

    asked on December 6, 2017
  17. physics

    the nail puller shown in the figure below you exert a force 53.2 cm from the pivot and the nail is 1.50 cm on the other side. What minimum force must you exert to apply a force of 1380 N to the nail to pull the nail up? 38.9 N is correct What is the

    asked on December 6, 2017
  18. physics

    A supertanker (mass = 1.57E+8 kg) is moving with a constant velocity. Its engines generate a forward thrust of 7.47E+5 N. Determine the magnitude of the resistive force exerted on the tanker by the water.

    asked on November 14, 2017
  19. physics

    When opening a door, you push on it perpendicularly with a force of 55.4 N at a distance of 0.728m from the hinges. What torque are you exerting relative to the hinges? (Does it matter if you push at the same height as the hinges?)

    asked on November 14, 2017
  20. physics

    Two children push on opposite sides of a door during play. Both push horizontally and perpendicular to the door. One child pushes with a force of 16.4 N at a distance of 0.590 m from the hinges, and the second child pushes at a distance of 0.470 m. What

    asked on November 14, 2017
  21. physics

    In the nail puller shown in the figure below you exert a force 53.2 cm from the pivot and the nail is 1.50 cm on the other side. What minimum force must you exert to apply a force of 1380 N to the nail to pull the nail up?

    asked on November 14, 2017
  22. physics

    How much work is done by the boy pulling his sister d = 25.0 m in a wagon as shown in figure below? Assume no friction acts on the wagon and he pulls with a force of 65.0 N and at an angle θ = 31.0°.

    asked on November 14, 2017
  23. physics

    Suppose a 300–g kookaburra (a large kingfisher bird) picks up a 77.0–g snake and raises it 2.70 m from the ground to a branch. How much work did the bird do on the snake? How much work did it do to raise its own center of mass to the branch?

    asked on November 14, 2017
  24. physics

    Calculate the force needed to bring a 1070–kg car to rest from a speed of 89.0 km/h in a distance of 110 m (a fairly typical distance for a non-panic stop). Suppose instead the car hits a concrete abutment at full speed and is brought to a stop in 2.34

    asked on November 14, 2017
  25. physics

    A 77.6 kg ice skater is skating along in a straight line (in the positive direction) at 10.3 m/s when he bends down and scoops up his 27.4 kg doggy sitting still on the ice. What will be the new velocity of the dog-n-skater?

    asked on November 14, 2017
  26. physics

    What is the average useful power output of a person who does 5.50×106 J of useful work in 6.50 h? Working at this rate, how long will it take this person to lift 1850 kg of bricks 1.20 m to a platform? (Work done to lift his body can be omitted because it

    asked on November 14, 2017
  27. physica

    A particle accelerates from rest at 6.1 m/s 2 . What is its speed 4.6 s after the particle starts moving?

    asked on November 13, 2017
  28. Math

    Each week Rosa receives a salary of $200 plus a 6 percent commission on her total sales. To the nearest dollar, how much would Rosa have to sell in one week to earn a total of $300

    asked on October 21, 2017
  29. Science

    A mouse that eats grass is called a ......

    asked on June 20, 2017
  30. Physics

    Brownian motion

    asked on June 18, 2017
  31. Algebra

    Suppose you want to draw a rectangle where the width is 7 inches less than the length and the diagonal is 7 inches longer than the length. What are the dimensions of the rectangle?

    asked on May 30, 2017
  32. reliabiility

    According to classical test theory, if the observed variance of a test is 50 and the true variance is 40, what is the estimated reliability of the test

    asked on April 22, 2017
  33. Math

    If rCosx=3 and rSinx=4, find the value of r and x.

    asked on April 21, 2017
  34. Literature

    Discuss the significance of the "Ale house" in Oliver Goldsmith's "She stoops to conquer"

    asked on April 21, 2017
  35. Physics

    A box (mass=34kg) is set on an incline (angle=36.5 degrees), attached to a string. The box is let go slowly with a tension of 205N on the string, and starts sliding down with an acceleration of 0.12m/s^2. What was the coefficient of kinetic friction

    asked on February 23, 2017
  36. statistics

    On a entrance exam, the mean was 50 and standard deviation was 5. If Ricky's z-score was -1.5, what was his exam score? I don't have a clue how to start to answer this question...

    asked on February 7, 2017
  37. maths

    Why is the open ended frequency distribution necessary

    asked on February 4, 2017
  38. Math

    Kay wants to know the length of large pond on property. One stake is at 50m with an angle of 21 degrees. The 65m from the other end of the lake and the angle is 26 degrees. How long is pond?

    asked on January 16, 2017
  39. Science

    What net force is required to accelerate a roller coaster car that has a mass of 300 kg at Disney world at a rate of 8 m/s2 ?

    asked on December 14, 2016
  40. Calculus

    A car moves along a straight road in such a way that its velocity (in feet per second) at any time t (in seconds) is given by v(t) = 3t * sqrt(49-t^2)

    asked on December 9, 2016
  41. Math

    Using the letters A and B, the following two-letter code words can be formed: AA, AB, BB,Ba. Using the letters A, B, and C, how many different three-letter code words can be formed? I know that the answer is 27 from the answer sheet, but how? Can you

    asked on November 26, 2016
  42. Math

    Kate uses a copy machine to enlarge her rectangular design that is 6 inches wide and 8 inches long. The new width is 10 inches long. What is the new length. I got some weird number like 13.333. I multiplied 8 times 10 and divided 80 by 6.

    asked on November 15, 2016
  43. Math

    Find the number of foul shots Ryan made if he made 60% of the total shots he took I am not sure how to set up the problem

    asked on October 26, 2016
  44. Calculus

    Can you please help me find the x and y intercepts of this equation. How do I solve this? y= x^2 √9-x^2

    asked on October 22, 2016
  45. Calculus

    I need help determining whether the following functions are even, odd, or neither. Please help me. 1. f(x)=4x+5 2. f(x)=x^3-x-2 3. f(x)=x^4-x / x^5-x 4. f(x)= x^3-x / x^5

    asked on October 15, 2016
  46. US Government

    Where in the Constitution does it give states equal representation in the Senate and also where is it stated or implied that it established states as vital components of the machinery of government? Please help.

    asked on October 6, 2016
  47. Calculus

    Write the equations of the circle in general form. 1. Points on circle (0,0), (0,8), (6,0) 2. Points on circle (1, -1), (2, -2), (0,-2). I don't know how to solve this given the fact that I don't know what the center or the radius of the circle is.

    asked on September 28, 2016
  48. physics

    We have a charge q = -0.6 x 10^-6 C at origin. And a vector r = (0 m, -5 m, 0 m). Find the electric field E(r) as a vector expressed in terms of i j and k. Ok so far I got E(r) = k (0.6e-6)/(5)^2 = 216 N/C. But this is not a vector, how do I express this

    asked on September 26, 2016
  49. Calculus

    Even after looking up how to do this and reading about it I still don't know how to find the slope of curve or the deritives . Please help solve these problems. 1. Y =x^3 p(-1, -1) 2. Y = x^4 /2 p(-1 , 1/2) 3. Y= 8x^4 -7x^2 +5x + 6 p(-1,2)

    asked on September 23, 2016
  50. Government

    If during the war, Congress has the power to declare war, what powers do the other branches of government have during the war?

    asked on September 21, 2016
  51. English

    I need help with writing a really good thesis statement regarding the stories Popular Mechanics by Raymond Carver and The Judgement of Solomon and their parenting styles. It's supposed to be compare and contrast but I'm stuck. Please help me.

    asked on September 21, 2016
  52. Math

    Please help me. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in both degrees and

    asked on September 18, 2016
  53. Algebra

    I don't know how to solve this at all. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in

    asked on September 17, 2016
  54. math

    before swimming andrea walks for 12 minutes and burns 60 calories. While swimming she burns 10 calories per minute. Write a variable expression for how many calories Andrea burns while walking for 12 minutes and swimming for m minutes.

    asked on September 12, 2016
  55. Math

    If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?

    asked on August 13, 2016
  56. Ross

    If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?

    asked on August 13, 2016
  57. Math

    How many 3 5\8 board can be cut from a 10 ft board?

    asked on August 6, 2016
  58. pre algebra

    The difference between two numbers is 44. Five times the smaller is equal to 8 more than the larger. What are the numbers

    asked on July 30, 2016
  59. Math

    laura spent 20 percent of her money on a dress. she spent 2/5 of the remainder on a book. she had $72 left. how much money did she have at first?

    asked on July 13, 2016
  60. Algebra

    X/5 -g=a for x

    asked on June 21, 2016
  61. math

    Flying against the wind, an airplane travels 5600 km in 8 hours. Flying with the wind, the same plane travels 9900 km in 9 hours.

    asked on May 26, 2016
  62. Global Communicaiton Studies

    Which socio-cultural variable is the most important and why? Looking forward to your insights. Thank you!

    asked on May 20, 2016
  63. Math- any help would be greatly appreciated

    In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.

    asked on May 19, 2016
  64. Math

    In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.

    asked on May 19, 2016
  65. precalculus

    A drug is administered every 6 hours. The kidney eliminates 55% of the drug over that period. The initial dose is 210 mg. Repeated dosage is 70 mg. What is the "differnece equation"?

    asked on May 17, 2016
  66. maths

    power supply in Nigeria is assumed to be normally distributed with daily mean at 68 minutes and variance 49 minutes .what is the probability of having power supply for (1) less than 45 minutes? (2) at least 1 hour? (3) between 75 minutes and 90 minutes?

    asked on May 11, 2016
  67. maths

    using determinant method find the area of the quadrilateral ABCD given the coordinates A(3,3) B(-2,5) c(-1,2) D(1,1)

    asked on May 11, 2016
  68. math

    my son informed me that a comic book I purchased for 10 cents in 1948 is worth $85. today what has been the average annual compound rate of return on that valuable asset

    asked on April 26, 2016
  69. Math

    In how many ways can 5 of 14 different sized and different colored beads be put on a string to form a necklace. would the answer be 14!/!9 ?

    asked on April 16, 2016
  70. Energy of satellite PHYSICS

    An m = 43 kg mass instrument package is put into orbit at an altitude above the Earth of A = 23000 km. What is the kinetic energy of this satellite in Joules?

    asked on April 10, 2016
  71. Biology

    I'm sorry but I had to post this question again as I left out the question. In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that

    asked on April 5, 2016
  72. Biology

    In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green melons and a plant that produced yellow melons. When the student

    asked on April 2, 2016
  73. math

    The sum of the digits on a digital clock is 15. The number of minutes is 5 times the number of hours. Wheat time is it?

    asked on April 1, 2016
  74. Pre-Calc

    If tan theta equal - square root of 22 divided by 11 and pie/2 is less than theta and theta is less than pies, what is the cos of theta in simplified rationalized form

    asked on March 14, 2016
  75. Math

    A cafe used 640 ounces of water to make tea how many quarts of water did the cafe USED

    asked on March 1, 2016
  76. Infinite math

    A company finds that producing 12 items costs $31, while producing 7 items costs $25. What's the company's marginal cost?

    asked on February 29, 2016
  77. math

    Home Depot wants to buy a new line of fertilizers. Manufacturer A offers a 19/14 chain discount. Manufacturer B offers a 24/12 chain discount. Both manufacturers have the same list price.

    asked on February 3, 2016
  78. business math

    Front Range Cabinet Distributors in Colorado Springs, Colorado, sells to its contractors with a 32% markup on cost. If the selling price for cabinets is $9,357, what is the cost to contractors based on cost?

    asked on February 1, 2016
  79. AP Chemistry

    Which of the following is true about lanthanides? A. they are all radioactive B. they are highly electropositive C. they are very common elements D. they have low melting and boiling points

    asked on January 29, 2016
  80. MATH


    asked on January 25, 2016
  81. math

    In 2013, the price of a business math text rose to $120. This is 10% more than the 2012 price. What was the old selling price?

    asked on January 15, 2016
  82. math

    Satelite Corporation projects a year-end net income of $64,497. The net income represents 31% of its projected annual sales. What are Satelite's projected annual sales?

    asked on January 14, 2016
  83. math

    The factory wants you to build a box that will hold twice as many cubes. What are the dimensions f a box that contains two times as many cubes as a box that is 2 by 3 by 4

    asked on January 13, 2016
  84. math

    a major airline laid of 4000 pilots and flight attendants. if this was 12.5% reduction in the workforce, what was the size of the workforce after layoffs?

    asked on January 12, 2016
  85. chemistry

    what is the advantage of using the indirect method over the direct method for calculating the enthalpy change of 2KHCO3 - K2CO3 + CO2 + H20

    asked on January 3, 2016
  86. Algebra

    Over 350 students took a college calculus final exam. the scores of the students follow a normal distribution. using the information given below, determine the mean and the standard deviation for the students'scores. Give your answers to the nearest tenth

    asked on December 27, 2015
  87. Chemistry

    Ammonium carbonate decomposes upon heating according to the balanced equation: (NH4)2CO3(s) -> 2NH3(g)+CO2(g)+H2O(g) Calculate the total volume of gas produced at 27.0 degrees C and 2.03 atm from the reaction of 1.4kg of (NH4)2CO3. What is the pressure of

    asked on December 3, 2015
  88. math

    I need to predict a certain number of pens in the bag how do i do this You have a bag of 100 pens you choose 7 green pens and 13 purple pens predict the number of purple pens in the bag.

    asked on November 23, 2015
  89. AP Lang

    If they give you a ruled paper, write the other way. What kindof figurative language is being used and what type of sentence is this

    asked on November 17, 2015
  90. Math

    If there are 10 more boys than girls,how many are girls and how many are boys? (I think out of 28)

    asked on November 7, 2015
  91. math

    First week sells 6 chairs for $80 each. Next week, if chair is not sold, it will sell for 0.85 times previous week's price. Store needs to sell 6 chairs for total of $270 to make a profit. what is the last week in which all 6 chairs could be sold so that

    asked on November 2, 2015
  92. Physics

    Two particles approach each other with equal and opposite speed v. The mass of one particle is m, and the mass of the other particle is nm, where n is just a unitless number. Snapshots of the system before, during, and after the elastic collision are shown

    asked on November 1, 2015
  93. physics

    Suppose the horizontal sweep of an oscilloscope takes 80ms how many cycles of a 100 Hz wave will be shown?

    asked on October 2, 2015
  94. English

    fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c

    asked on September 24, 2015
  95. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A

    asked on September 24, 2015
  96. Need HELP reall bad test tommorrow

    how to make a xy table for the following greatest integer equation. f(x)=2[x], g(x)=[2x], f(x)=-[[x]], and g(x)=[[-x]] thank you for the help

    asked on September 21, 2015
  97. Finance

    Suppose the firm (has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) had 85,000 shares of common stock outstanding. What is the earnings per share, or EPS, figure? What is

    asked on September 2, 2015
  98. Finance

    Suppose the firm in paid out (sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) $73,000 in cash dividends. What is the addition to retained earnings?

    asked on September 2, 2015
  99. Finance

    Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?

    asked on September 2, 2015
  100. algebra

    your test scores in one class are 80 and 88. what possible scores can you earn on your next test to have a test average between 84 and 89, inclusive?

    asked on September 1, 2015


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10