Stephanie

Newest questions posted by Stephanie
  1. English

    In not less than 350 word's write about Nigeria my county
  2. Math

    to celebrate the first day of a leap year, i taught my dog to jump through a hoop. it was a sunday. when he taught me the same trick the first day of the next year, it was a ? a. sunday b. monday c. tuesday d. wednesday is tuesday the correct answer?
  3. Math

    A plane left Atlanta at 11:30 AM and flew to an airport near Boston. The plane was due to arrive at 3:15 PM. The plane arrived 25 minutes late. The time of the trip was: Is the answer 4 hours and 10 minutes?
  4. math

    if a man travels r miles and hour for h hours and s miles an hour for t hours, what is his average rate in miles per hour for the ENTIRE distance traveled? a. rh+st b. r/h+s/t c. rh+st/2 d. rh+st/h+t is the answer b?
  5. Math 201

    I am having problems with this question in my math class. Consider a student loan of ​$25,000.00 at a fixed APR of 12% for 25 years. a. Calculate the monthly payment. The monthly payment is $263.31 b. Determine the total amount paid over the term of the
  6. Chemistry

    Calculate the relative effusion rate of hydrogen and oxygen, given that both the gases are diatomic, with hydrogen having a molar mass of 2 grams and oxygen having a molar mass of 32 grams. Using Graham’s law equation.
  7. Science

    What is the effect of hunting in the gender of species?
  8. physics

    What is the average useful power output of a person who does 5.50×106 J of useful work in 6.50 h? 235 W correct answer Working at this rate, how long will it take this person to lift 1850 kg of bricks 1.20 m to a platform? (Work done to lift his body can
  9. physics

    Calculate the force needed to bring a 1070–kg car to rest from a speed of 89.0 km/h in a distance of 110 m (a fairly typical distance for a non-panic stop). -2.97×103 N correct answer Suppose instead the car hits a concrete abutment at full speed and is
  10. physics

    the nail puller shown in the figure below you exert a force 53.2 cm from the pivot and the nail is 1.50 cm on the other side. What minimum force must you exert to apply a force of 1380 N to the nail to pull the nail up? 38.9 N is correct What is the
  11. physics

    A supertanker (mass = 1.57E+8 kg) is moving with a constant velocity. Its engines generate a forward thrust of 7.47E+5 N. Determine the magnitude of the resistive force exerted on the tanker by the water.
  12. physics

    When opening a door, you push on it perpendicularly with a force of 55.4 N at a distance of 0.728m from the hinges. What torque are you exerting relative to the hinges? (Does it matter if you push at the same height as the hinges?)
  13. physics

    Two children push on opposite sides of a door during play. Both push horizontally and perpendicular to the door. One child pushes with a force of 16.4 N at a distance of 0.590 m from the hinges, and the second child pushes at a distance of 0.470 m. What
  14. physics

    In the nail puller shown in the figure below you exert a force 53.2 cm from the pivot and the nail is 1.50 cm on the other side. What minimum force must you exert to apply a force of 1380 N to the nail to pull the nail up?
  15. physics

    How much work is done by the boy pulling his sister d = 25.0 m in a wagon as shown in figure below? Assume no friction acts on the wagon and he pulls with a force of 65.0 N and at an angle θ = 31.0°.
  16. physics

    Suppose a 300–g kookaburra (a large kingfisher bird) picks up a 77.0–g snake and raises it 2.70 m from the ground to a branch. How much work did the bird do on the snake? How much work did it do to raise its own center of mass to the branch?
  17. physics

    Calculate the force needed to bring a 1070–kg car to rest from a speed of 89.0 km/h in a distance of 110 m (a fairly typical distance for a non-panic stop). Suppose instead the car hits a concrete abutment at full speed and is brought to a stop in 2.34
  18. physics

    A 77.6 kg ice skater is skating along in a straight line (in the positive direction) at 10.3 m/s when he bends down and scoops up his 27.4 kg doggy sitting still on the ice. What will be the new velocity of the dog-n-skater?
  19. physics

    What is the average useful power output of a person who does 5.50×106 J of useful work in 6.50 h? Working at this rate, how long will it take this person to lift 1850 kg of bricks 1.20 m to a platform? (Work done to lift his body can be omitted because it
  20. physica

    A particle accelerates from rest at 6.1 m/s 2 . What is its speed 4.6 s after the particle starts moving?
  21. Math

    Each week Rosa receives a salary of $200 plus a 6 percent commission on her total sales. To the nearest dollar, how much would Rosa have to sell in one week to earn a total of $300
  22. Science

    A mouse that eats grass is called a ......
  23. Physics

    Brownian motion
  24. Algebra

    Suppose you want to draw a rectangle where the width is 7 inches less than the length and the diagonal is 7 inches longer than the length. What are the dimensions of the rectangle?
  25. reliabiility

    According to classical test theory, if the observed variance of a test is 50 and the true variance is 40, what is the estimated reliability of the test
  26. Math

    If rCosx=3 and rSinx=4, find the value of r and x.
  27. Literature

    Discuss the significance of the "Ale house" in Oliver Goldsmith's "She stoops to conquer"
  28. Physics

    A box (mass=34kg) is set on an incline (angle=36.5 degrees), attached to a string. The box is let go slowly with a tension of 205N on the string, and starts sliding down with an acceleration of 0.12m/s^2. What was the coefficient of kinetic friction
  29. statistics

    On a entrance exam, the mean was 50 and standard deviation was 5. If Ricky's z-score was -1.5, what was his exam score? I don't have a clue how to start to answer this question...
  30. maths

    Why is the open ended frequency distribution necessary
  31. Math

    Kay wants to know the length of large pond on property. One stake is at 50m with an angle of 21 degrees. The 65m from the other end of the lake and the angle is 26 degrees. How long is pond?
  32. Science

    What net force is required to accelerate a roller coaster car that has a mass of 300 kg at Disney world at a rate of 8 m/s2 ?
  33. Calculus

    A car moves along a straight road in such a way that its velocity (in feet per second) at any time t (in seconds) is given by v(t) = 3t * sqrt(49-t^2)
  34. Math

    Using the letters A and B, the following two-letter code words can be formed: AA, AB, BB,Ba. Using the letters A, B, and C, how many different three-letter code words can be formed? I know that the answer is 27 from the answer sheet, but how? Can you
  35. Math

    Kate uses a copy machine to enlarge her rectangular design that is 6 inches wide and 8 inches long. The new width is 10 inches long. What is the new length. I got some weird number like 13.333. I multiplied 8 times 10 and divided 80 by 6.
  36. Math

    Find the number of foul shots Ryan made if he made 60% of the total shots he took I am not sure how to set up the problem
  37. Calculus

    Can you please help me find the x and y intercepts of this equation. How do I solve this? y= x^2 √9-x^2
  38. Calculus

    I need help determining whether the following functions are even, odd, or neither. Please help me. 1. f(x)=4x+5 2. f(x)=x^3-x-2 3. f(x)=x^4-x / x^5-x 4. f(x)= x^3-x / x^5
  39. US Government

    Where in the Constitution does it give states equal representation in the Senate and also where is it stated or implied that it established states as vital components of the machinery of government? Please help.
  40. Calculus

    Write the equations of the circle in general form. 1. Points on circle (0,0), (0,8), (6,0) 2. Points on circle (1, -1), (2, -2), (0,-2). I don't know how to solve this given the fact that I don't know what the center or the radius of the circle is.
  41. physics

    We have a charge q = -0.6 x 10^-6 C at origin. And a vector r = (0 m, -5 m, 0 m). Find the electric field E(r) as a vector expressed in terms of i j and k. Ok so far I got E(r) = k (0.6e-6)/(5)^2 = 216 N/C. But this is not a vector, how do I express this
  42. Calculus

    Even after looking up how to do this and reading about it I still don't know how to find the slope of curve or the deritives . Please help solve these problems. 1. Y =x^3 p(-1, -1) 2. Y = x^4 /2 p(-1 , 1/2) 3. Y= 8x^4 -7x^2 +5x + 6 p(-1,2)
  43. Government

    If during the war, Congress has the power to declare war, what powers do the other branches of government have during the war?
  44. English

    I need help with writing a really good thesis statement regarding the stories Popular Mechanics by Raymond Carver and The Judgement of Solomon and their parenting styles. It's supposed to be compare and contrast but I'm stuck. Please help me.
  45. Math

    Please help me. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in both degrees and
  46. Algebra

    I don't know how to solve this at all. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in
  47. math

    before swimming andrea walks for 12 minutes and burns 60 calories. While swimming she burns 10 calories per minute. Write a variable expression for how many calories Andrea burns while walking for 12 minutes and swimming for m minutes.
  48. Math

    If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?
  49. Ross

    If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?
  50. Math

    How many 3 5\8 board can be cut from a 10 ft board?
  51. pre algebra

    The difference between two numbers is 44. Five times the smaller is equal to 8 more than the larger. What are the numbers
  52. Math

    laura spent 20 percent of her money on a dress. she spent 2/5 of the remainder on a book. she had $72 left. how much money did she have at first?
  53. Algebra

    X/5 -g=a for x
  54. math

    Flying against the wind, an airplane travels 5600 km in 8 hours. Flying with the wind, the same plane travels 9900 km in 9 hours.
  55. Global Communicaiton Studies

    Which socio-cultural variable is the most important and why? Looking forward to your insights. Thank you!
  56. Math- any help would be greatly appreciated

    In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.
  57. Math

    In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.
  58. precalculus

    A drug is administered every 6 hours. The kidney eliminates 55% of the drug over that period. The initial dose is 210 mg. Repeated dosage is 70 mg. What is the "differnece equation"?
  59. maths

    power supply in Nigeria is assumed to be normally distributed with daily mean at 68 minutes and variance 49 minutes .what is the probability of having power supply for (1) less than 45 minutes? (2) at least 1 hour? (3) between 75 minutes and 90 minutes?
  60. maths

    using determinant method find the area of the quadrilateral ABCD given the coordinates A(3,3) B(-2,5) c(-1,2) D(1,1)
  61. math

    my son informed me that a comic book I purchased for 10 cents in 1948 is worth $85. today what has been the average annual compound rate of return on that valuable asset
  62. Math

    In how many ways can 5 of 14 different sized and different colored beads be put on a string to form a necklace. would the answer be 14!/!9 ?
  63. Energy of satellite PHYSICS

    An m = 43 kg mass instrument package is put into orbit at an altitude above the Earth of A = 23000 km. What is the kinetic energy of this satellite in Joules?
  64. Biology

    I'm sorry but I had to post this question again as I left out the question. In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that
  65. Biology

    In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green melons and a plant that produced yellow melons. When the student
  66. math

    The sum of the digits on a digital clock is 15. The number of minutes is 5 times the number of hours. Wheat time is it?
  67. Pre-Calc

    If tan theta equal - square root of 22 divided by 11 and pie/2 is less than theta and theta is less than pies, what is the cos of theta in simplified rationalized form
  68. Math

    A cafe used 640 ounces of water to make tea how many quarts of water did the cafe USED
  69. Infinite math

    A company finds that producing 12 items costs $31, while producing 7 items costs $25. What's the company's marginal cost?
  70. math

    Home Depot wants to buy a new line of fertilizers. Manufacturer A offers a 19/14 chain discount. Manufacturer B offers a 24/12 chain discount. Both manufacturers have the same list price.
  71. business math

    Front Range Cabinet Distributors in Colorado Springs, Colorado, sells to its contractors with a 32% markup on cost. If the selling price for cabinets is $9,357, what is the cost to contractors based on cost?
  72. AP Chemistry

    Which of the following is true about lanthanides? A. they are all radioactive B. they are highly electropositive C. they are very common elements D. they have low melting and boiling points
  73. MATH

    HOW MANY CALORIES IS IN ONE BANANA?
  74. math

    In 2013, the price of a business math text rose to $120. This is 10% more than the 2012 price. What was the old selling price?
  75. math

    Satelite Corporation projects a year-end net income of $64,497. The net income represents 31% of its projected annual sales. What are Satelite's projected annual sales?
  76. math

    The factory wants you to build a box that will hold twice as many cubes. What are the dimensions f a box that contains two times as many cubes as a box that is 2 by 3 by 4
  77. math

    a major airline laid of 4000 pilots and flight attendants. if this was 12.5% reduction in the workforce, what was the size of the workforce after layoffs?
  78. chemistry

    what is the advantage of using the indirect method over the direct method for calculating the enthalpy change of 2KHCO3 - K2CO3 + CO2 + H20
  79. Algebra

    Over 350 students took a college calculus final exam. the scores of the students follow a normal distribution. using the information given below, determine the mean and the standard deviation for the students'scores. Give your answers to the nearest tenth
  80. Chemistry

    Ammonium carbonate decomposes upon heating according to the balanced equation: (NH4)2CO3(s) -> 2NH3(g)+CO2(g)+H2O(g) Calculate the total volume of gas produced at 27.0 degrees C and 2.03 atm from the reaction of 1.4kg of (NH4)2CO3. What is the pressure of
  81. math

    I need to predict a certain number of pens in the bag how do i do this You have a bag of 100 pens you choose 7 green pens and 13 purple pens predict the number of purple pens in the bag.
  82. AP Lang

    If they give you a ruled paper, write the other way. What kindof figurative language is being used and what type of sentence is this
  83. Math

    If there are 10 more boys than girls,how many are girls and how many are boys? (I think out of 28)
  84. math

    First week sells 6 chairs for $80 each. Next week, if chair is not sold, it will sell for 0.85 times previous week's price. Store needs to sell 6 chairs for total of $270 to make a profit. what is the last week in which all 6 chairs could be sold so that
  85. Physics

    Two particles approach each other with equal and opposite speed v. The mass of one particle is m, and the mass of the other particle is nm, where n is just a unitless number. Snapshots of the system before, during, and after the elastic collision are shown
  86. physics

    Suppose the horizontal sweep of an oscilloscope takes 80ms how many cycles of a 100 Hz wave will be shown?
  87. English

    fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c
  88. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A
  89. Need HELP reall bad test tommorrow

    how to make a xy table for the following greatest integer equation. f(x)=2[x], g(x)=[2x], f(x)=-[[x]], and g(x)=[[-x]] thank you for the help
  90. Finance

    Suppose the firm (has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) had 85,000 shares of common stock outstanding. What is the earnings per share, or EPS, figure? What is
  91. Finance

    Suppose the firm in paid out (sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) $73,000 in cash dividends. What is the addition to retained earnings?
  92. Finance

    Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?
  93. algebra

    your test scores in one class are 80 and 88. what possible scores can you earn on your next test to have a test average between 84 and 89, inclusive?
  94. Algebra 2

    a car travels for 2 hours at r mph and then decreases its speed by 5mph for the next 3 hours. What is total time traveled?
  95. English

    Samuel Johnson's Letter to Lord Chesterfield ? Help? Where in the letter does the tone seem ironic? And also where does the tone shift? Please Help
  96. Pre-Calculus

    How do I solve these equations? I need to create an equation given the characteristics? I have to be able to graph a parabola but first I need help solving this. 1.Focus (1.5,1); opens right; directrix x=0.5 2.Focus (1,4);opens down; contains (-3,1)
  97. English

    1.If para- means beyond, then a paradox is something that is... 2.Examples of dogma 3.Using literal translations without the dictionary. -The prefix ortho- means "straight" or "correct" -The prefix hetero means "different" -The prefix homo means "same"
  98. Algebra

    Explain how the graph of f(x) = ln x can be used to obtain the graph of g(x) = e^(x-2).
  99. Algebra

    Explain why an even function does not have an inverse that is a function.
  100. Math (Finite)

    In how many ways can a committee of 7 people be chosen from 15 married couples if 2 couples must be on the committee?

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9