Aisha

Newest questions and responses by Aisha
  1. Math

    An equilateral triangle of side 20cm is inscribed in a circle. Calculate the distance of a side of the triangle from the center of the circle.

    asked on October 4, 2018
  2. Science

    Two equal and oppisitely directed forces acting on an object will be in equilibrium . (a)only if they act on the same point on he object. (b)if they are separated by a distance. (c)when they are balanced by a third force. (d)when their moments about the

    asked on April 19, 2018
  3. CHEMISTRY

    WHAT PRESSURE WILL BE COMPRESS 7.75 LITRES OF HYDROGEN AT ATMOSPHERIC PRESSURE TO 5 LITRES?

    asked on February 3, 2018
  4. science

    A body was moving with a velocity 60km/hour. It is brought to rest by applying a force of 200newton.Find the mass of body in5sec

    asked on November 19, 2017
  5. MATH

    WHILE SETTING UP THE STORE AND SHOPPING, HOW WE CAN ENSURE THE ASPECTS OF KINDNESS, NEATNESS AND SAFETY?

    asked on November 16, 2017
  6. Math

    a square carpet covers 60% of the floor area the room is 5m by 5m what are the dimensions of the carpet

    asked on July 14, 2017
  7. chemistry

    water cannot cook beans on the moon.explain

    asked on April 28, 2017
  8. Science

    Which statement correctly describes the sun and earth? a. the sun and earth both have water. b. the sun and earth both have a surface called the crust. c. the sun and earth both have an atmosphere d. the sun and earth both have breathable air

    asked on March 9, 2017
  9. operation and production management

    what is meant by "operations" in a. a hospital b. a university c. a commercial bank

    asked on February 26, 2017
  10. Maths bearing

    City A is 300km due east of city B ..city C is 200km on a bearing of 123* from city B how far is it from C to A

    asked on February 19, 2017
  11. algebra

    peter has n marbles. He has 5 more marbles than Tom. How many marbles does Tom have?

    asked on February 2, 2017
  12. algebra

    there are x dozen of oranges in a shop. how many oranges are there in this shop?

    asked on February 1, 2017
  13. algebra

    the area of a triangle is 40cm2. the height of it is h cm. what is the lenght of its base?

    asked on February 1, 2017
  14. English

    What does the knife symbolize in the story "knife"?

    asked on January 23, 2017
  15. Math- fractions

    A cookie recipe calls for 3/4 cup of chocolate chips.Spencer has 2/3 cup. Does he have enough?If your answer is yes ,explain.If your answer is no, how much more does Spencer need?

    asked on January 15, 2017
  16. physics

    In Figure 10-1, if the force exerted on a 3.0-kg backpack that is initally at rest is 20.0 N and the distance it acts over is 0.25 m, what is the final speed of the backpack?

    asked on December 19, 2016
  17. Communications 12

    When writing an expository paragraph do you put the characters names in quotations?

    asked on December 2, 2016
  18. science

    explain to to transfer heat from a electric stove?

    asked on June 22, 2016
  19. math

    384,239

    asked on April 24, 2016
  20. algebra

    638 divided by 8

    asked on April 23, 2016
  21. Chemistry

    15.0 ml of 0.50 M NaOH is added to a 100.-mL sample of 0.442 M NH3 (kb for NH3= 1.8 x 10^-5). What is the equilibrium concentration of NH4+ ions?

    asked on April 7, 2016
  22. History

    The U.S. Army at first failed to stop raids by Native Americans for all these reasons EXCEPT? a. it failed to build forts. b. the soldiers were untrained. c.the soldiers were inexperienced. d. it did not have enough soldier

    asked on March 30, 2016
  23. business math

    Joanne and Ed Greenwood built a new barn with an attached arena. To finance the loan, they paid $1,261 interest on $52,600 at 5%. What was the time, using exact interest?

    asked on March 5, 2016
  24. biology

    Looking through a microscope,I saw a Eukaryotic cell. How could I conclude if the cell is a plant or animal cell?

    asked on January 6, 2016
  25. MATHS

    In a triangle ABC, angle B> angle C. If AM is the bisector of angle A and An is perpendicular to BC. Prove that angle MAN=1/2(angle B-angle C).

    asked on June 14, 2015
  26. geography

    what does intentional trade have to do with canada's free trade history

    asked on June 8, 2015
  27. geography

    what does the drop in canada's imagration rate have to do with learning about imagration and canada's role in it

    asked on June 3, 2015
  28. science

    100mL of oxalic acid (H2C2O4) requires 35mL of 0.04M KMnO4 to titrate it to the endpoint. calculate the molarity of the oxalic acid.

    asked on April 6, 2015
  29. Legal Studies

    Identify key personnel working in the courtroom.Outline their role.

    asked on April 4, 2015
  30. physics

    if an iron cube of volume 400cm3 is immersed in water,the upthrust will be?

    asked on March 19, 2015
  31. chemistry

    What would be the MOLARITY (M) of the NaBr in the same buffer solution, if its concentration is now 0.9% (w/v)? Relative atomic masses:Na = 23; Br = 80

    asked on October 24, 2014
  32. physics

    A person walk up a stalled escalator in 90sec.when standing on the same escalator now moving,he is carried in 60 sec.the time he would take to walk up the moving escalator will be.

    asked on August 10, 2014
  33. Science

    What is an example of inbreeding? Please tell me.

    asked on January 13, 2014
  34. math

    a player made 20 freethrows in first half which was 80% of attemted that half. how many were attempted that half

    asked on January 10, 2014
  35. Math

    2 expression for the perimeter of a square 1 with brackets and 1 without The shape is a square and t+3 is 1 side of the square P(with brackets) P(without brackets)

    asked on November 18, 2013
  36. emu

    a bullet of mass ..21kg is fired from a gun of a mass 5.6kg. if gun is recoiled at a speed of 2.5 m/s .What speed must the bullet have as it leaves the gun

    asked on November 7, 2013
  37. biology

    The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please

    asked on September 25, 2013
  38. biology

    4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions)

    asked on September 25, 2013
  39. physics

    The inverted pendulum shown consists of a uniform rod of length L and mass M hinged at its base. A spring is attached a distance h from the pendulum’s pivot and has a spring constant k. At equilibrium the pendulum is perfectly vertical. For small

    asked on May 1, 2013
  40. math

    i have a test tomorrow and im still not sure how to do this. can you please help me? p={a,b,c} Q={a,c,d,f} Q-P=?

    asked on April 23, 2013
  41. maths

    solve 2x+3y=13 with 4x+5y=23

    asked on March 20, 2013
  42. chemistry

    2NaOH + H2SO4 yields Na2SO4+2H2O calculate the molarity of H2SO4

    asked on March 8, 2013
  43. science

    What is true about the amplitude of a tsunami? A- it increases in shallow water near the shore. B- is is always lower in amplitude that a wave made by wind C- it is high enough to topple ocean liner far out sea. D- in deep water, it is 3 times higher than

    asked on January 11, 2013
  44. 7th grade science

    What could increase the damage to human built structures during an earthquake? A-buildings far away from the pint of origin of the earthquake B- loose material in underlying land C- solid rock beneath buildings D-flexible buildings is it C???

    asked on January 11, 2013
  45. maths

    the minute hand of a circular clock is 18cm long how far gdoes the tip of the hand move in 2 hours

    asked on January 3, 2013
  46. maths

    the circumference of a circle 314cm find the radius and the area

    asked on January 3, 2013
  47. maths

    a circular flower bed is surrounded by a path 3m wide the diameter is 44m what is the area of this path

    asked on January 3, 2013
  48. calculus

    find derivative y= (3x^5-6x^3)/7secx

    asked on December 18, 2012
  49. calculus

    find derivative y= 3x^5-6x^3/7secx find dy/dx * xcosy= 5( y+cosx) * X^5-Y^3+8XY=466 * A RIGHT TRIANGLE HAS LEGS OF LENGTH 15M AND 7M. THE 7M LEG IS NOT CHANGING. 15M LEG IS GETTING LONGER AT RATE OF 8M PER SECOND. SO WHAT IS RATE OF CHANGE OF THE

    asked on December 17, 2012
  50. math

    A blue light every 30seconds. A red light blinks every 40seconds. If both lights blink at exactly 1:00pm, at what time will they blink at the same time again?

    asked on December 12, 2012
  51. chemistry

    how to calculate activation energy and frequency factor

    asked on October 22, 2012
  52. 7th grade social studies

    Explain the quote by Samuel de Champlain in your own words. "Through (exploration) we gain knowledge of different countries, regions and kingdoms; through it we attract and bring into our countries all kinds of riches; through it... Christianity (is

    asked on September 28, 2012
  53. ms.sue(social studies)

    Ms.Sue about the question of the the Protestant Reformation is it that England was christian and France wasn't or something else (please help)

    asked on September 28, 2012
  54. social studies

    Explain how the Protestant Reformation led to war between England and France in the 16th century?

    asked on September 27, 2012
  55. vocabulary

    what does vain mean in simple words please?

    asked on September 26, 2012
  56. HELP

    I am writing and essay for social studies and i only have a conclusion left please help!!!! The essay is about the war of England and Spain in the 1500's their war about cultures and i want to finish this essay so i need help with the conclusion!

    asked on September 26, 2012
  57. social studies

    Why did Spain attack, England in the late 1500's? {2 reasons} How did Spain's defeat lead to the weakening of the Spanish Empire?

    asked on September 26, 2012
  58. ela

    How can making inferences in literature help you determine how the societal conflicts can make your identity?

    asked on September 22, 2012
  59. the girl who could fly book

    Can somebody help me with this question, it is about the book the girl who could fly How can making inferences in literature help you determine how the societal conflicts in I.N.S.A.N.E. shaped Piper's identity?

    asked on September 22, 2012
  60. science-physics

    a battery of 12v supplies a charge of 1000C to an electric device. how much work is done by the battery in moving the charge?

    asked on July 23, 2012
  61. statistics

    Acrylic bone cement is commonly used in total joint replacement to secure the artificial joint. Data on the force (measured in Newtons, N) required to break a cement bond was determined under two different temperature conditions and in two different

    asked on June 29, 2012
  62. Community service

    Help! I need to do 40 hours of community service by 2 weeks. In my nieghborhood there are no libraries, or anything and I have no idea what to do. I need to do this because it is mandatory for honor students like me! The past month went by , because of

    asked on May 27, 2012
  63. math

    Can you help me with this integer problem? -8+6+(-10)+(-2)*(-10) is it 8????

    asked on May 15, 2012
  64. ela

    I need a attention grabber for, a newspaper article. It is based on the giver, it is about a ceremony that is about to begin i need a attention grabber for that.

    asked on May 14, 2012
  65. owning and operating a car

    It is important to make sure that any person selling you a car has? A. physical possession of the vehicle. B. informed the motor vehicles department of the intention to sell the vehicle. C. legal title to the vehicle. D. a good reputation for honesty.

    asked on May 14, 2012
  66. science fair

    I need a science fir project!! I looked on a thousand of websites online but they give no interesting idea. I am in 6th grade and i need something at a 6 grade level that is easy a science fair project that is do in 1 week. i am in 6 grade and i don't need

    asked on April 26, 2012
  67. math

    Steven made 9 napkins out 1 1/2 yards. All the napkins were equal sizes. So based on this information how many yards will it take for Steven to make 30 napkins of equal size?

    asked on April 25, 2012
  68. please help me

    A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion How far did it roll during the first 5.5 s of motion? x=

    asked on March 6, 2012
  69. physics

    A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion. How far did it roll during the first 5.5 s of motion? Express your answer using two significant figures. x= m

    asked on March 5, 2012
  70. physics

    A rocket carrying a satellite is accelerating straight up from the earth's surface. At 1.25 s after liftoff, the rocket clears the top of its launch platform, 69 m above the ground. After an additional 4.80 s , it is 1.00 km above the ground. Calculate the

    asked on March 5, 2012
  71. physics

    An egg is thrown nearly vertically upward from a point near the cornice of a tall building. It just misses the cornice on the way down and passes a point a distance 48.0 m below its starting point at a time 5.00s after it leaves the thrower's hand. Air

    asked on March 5, 2012
  72. physics

    A meter stick is held vertically above your hand, with the lower end between your thumb and first finger. On seeing the meter stick released, you grab it with these two fingers. You can calculate your reaction time from the distance the meter stick falls,

    asked on March 5, 2012
  73. physics

    The human body can survive a negative acceleration trauma incident (sudden stop) if the magnitude of the acceleration is less than (m/s2) If you are in an automobile accident with an initial speed of 101(km/h) and are stopped by an airbag that inflates

    asked on March 5, 2012
  74. physics

    Ricardo and Jane are standing under a tree in the middle of a pasture. An argument ensues, and they walk away in different directions. Ricardo walks 22.0 in a direction 60.0 west of north. Jane walks 10.0 in a direction 30.0 south of west. They then stop

    asked on March 4, 2012
  75. Science collage

    A jetliner lands at speed of 210 km/h and breaks at rate of 20 km/h/s . If the jatliner travels at a constant speed of 210 km/h for 1s after landing before applying the breakes . What is the total displacement of the jetliner between couchdown on the

    asked on January 4, 2012
  76. chemistry

    what volume of 0.1 moldm-3 HCL acid would be required to dissolve 2.3 grams of calcium carbonate equation CaCO3+2HCL----------=CaCl2+CO2+H20 (WATER)

    asked on September 25, 2011
  77. math213

    In each of the following, order decimals from least to greatest a.24,9419, 24.942, 24,94189, 24.94199 b.-34.25, -34.251, -34.205, -34.2519

    asked on September 5, 2011
  78. math

    Convert eat of the following repeating decimal to a/b form, where a and b are integers and b doesn't equal 0. a. 0.7 c. 2.37 e. -4.34

    asked on September 2, 2011
  79. physics

    A cyclist is cycling at a uniform velocity of 8m/s for 8 seconds. He then stops paddling and the cycle comes to rest in next ten seconds. Draw the velocity-time graph and calculate: (i) the average retardation.(ii) the distance covered with uniform

    asked on August 7, 2011
  80. Devry

    One of your corporate clients has approached you about whether or not its employees are required to include certain benefits provided by the corporation in their income. In particular, the corporation has inquired whether the following benefits provided by

    asked on June 22, 2011
  81. Geometry

    Find The coordinates of G'reflected in the x-axis if the coordinates of G are (4,-3)

    asked on June 8, 2011
  82. geometry

    sketch label and mark each figure 1.Isoscles obtuse triangle TRI with vertex angle T. 2.Rhombus RHOM with acute

    asked on April 23, 2011
  83. geometry

    What are the values of a and b.if any,where a|b-2|

    asked on April 23, 2011
  84. geometry

    From the top of a lighthouse 210 feet high, the angle of depression to a boat is 27 degress. Find the distance from the boat to the food of the lighthouse. The lighthouse was built at sea level? Please help and for some sugesstions

    asked on April 23, 2011
  85. English

    In Literature, what were the goals in the Harlem Renaissance? I could only think of one. -To show the Negro as a capable individuals

    asked on March 31, 2011
  86. business managment

    how might a walmart representative respond to the negetive criticism that might arise as result of sighting a new facility in a community ranging from traffic congestion to anti-union sentiment to unfair competition?

    asked on March 23, 2011
  87. maths

    the length of a rectangle is 3 less than 5 times its width. Write a simpified algebriac expression for the perimeter of a rectangle. If the rectangle width is tripled and its length is doubled,the perimeter of new rectangle is 92cm greater than the

    asked on November 24, 2010
  88. 11th grade english

    What is a good thesis statement on the destruction of world due to food we eat for my critical analysis paper?

    asked on October 23, 2010
  89. social studies

    the form of government used in most of louisisana's parishes is called what

    asked on September 23, 2010
  90. social studies

    the process of redrawing the boundaries of legislative districts is called what

    asked on September 23, 2010
  91. Social Studies

    A document that sets up broad organization of a government and the rules under which it will operate is called what.

    asked on September 23, 2010
  92. ETH/125

    Checkpoint: Legislation Legacy Resources: National Congress of American Indians Web site Country Newspaper at · Due Date: Day 5 (Friday) Please post in your Individual Forum · Post a 200- to 300-word summary of a current issue between Native Americans

    asked on May 27, 2010
  93. sci/275

    research due day 2 (tuesday) wk 6 sci/275 Exercise: Final Paper Research Due Day 2 (Tuesday) Please post in your Individual Forum · Resource: Appendix A · Review the environmental issues that are covered in this course. · Choose an environmental issue

    asked on May 27, 2010
  94. SCI/275

    CheckPoint #6: Water Resource Challenges Due Thursday *Post as an attachment** in your Individual Forum . Water Resource Challenges Review Ch. 10 and 11 of your text, then complete the following: Provide at least three freshwater and three ocean water

    asked on May 27, 2010
  95. college Math

    (x-y)/(4x+3y)=6x find dy/dx by implicit differentiation.

    asked on April 12, 2010
  96. algebra 2

    determine whether the data in the table appears to be positively skewed, negatively skewed, or normally distributed. explain

    asked on December 23, 2009
  97. algebra 2

    Evaluate C(12,10)

    asked on December 23, 2009
  98. algebra2

    solve: 8 t - 3 1 - ---- = ------ + ---- t + 5 t + 5 3

    asked on December 23, 2009
  99. algebra2

    list all of the possible rational zeros of f(x) = 3x^5 - 7x^3 + 2x - 15.

    asked on December 23, 2009
  100. algebra2

    state the number of positive real zeros, negative real zeros, and imaginary zeros for g(x) = 9x^3 - 7x^2 +10x - 4

    asked on December 23, 2009

Pages

  1. 1
  2. 2