1. economics

    Suppose that the company Mama's Pies adds another store to sell its pastries. Supposed that it costs $400,000 to build the new store and assume that the new store will generate revenues of $450,000. What is the rate of return on this investment?

    asked by marry on February 14, 2012
  2. alg2

    suppose you drop a tennis ball from a height of 15 feet. After the ball hits the floor, it rebounds to 85% of its previous height. How high will the ball rebound after its third bounce. round to the nearest tenth.. my teacher told be the answers 9.2 but i

    asked by jerson on June 9, 2008
  3. Math

    A garden is 3m wThere is a pathway that runs along the perimeter inside the garden.If the area of pathway is half of the area of garden, then the width of the pathway is how many meters?

    asked by Lala on September 27, 2016
  4. math30

    A sequence has a first term of 24 and every other term is one half of the previous term. Find a recursive formula that defines this sequence. The answer of this question is: an=an-1*1/2 Somebody can help me and let me know why is 1/2 on the formula? please

    asked by alejandro on August 23, 2012
  5. Chemistry

    1) How many miles are covered in a 15km race? (1 mile=5280, 12 in=1 ft, 1in=2.54cm) I know that I have to convert but I do not know where to start. 2) Silver (107.87amu) has two naturally occuring isotopes. In a typical sample, 51.84%of silver exists as

    asked by Hannah on December 4, 2011
  6. Stats

    A prototype from a hybrid vehicle manufacturer claims to get 50 miles per gallon (MPG). The manufacturer selects 14 prototypes from their fleet and drives the vehicles for fuel efficiency. The sample mean fuel efficiency for this sample was 53.3MPG and a

    asked by Plzz help on November 6, 2016
  7. Social Studies

    1. what time was the first target hit at Pearl Harbor? Answer: 7:53 a.m. 2. Who said, "A day which will live in infamy"? Answer: President Franklin D. Roosevelt 3. Which ships were placed within 12 miles from the island? Answer: Ward, Vega, and Antares 4.

    asked by CHECK ANSWERS PLEASE on May 13, 2014
  8. Reading

    Read the instructions below and answer the questions Preheat the oven to 350°F. Spray a cookie sheet with a non-stick spray. Roll the previously refrigerated cookie dough into 1 inch balls. Arrange on the cookie sheet 2cm apart. When the oven is hot, bake

    asked by Monster on February 19, 2019
  9. chemistry

    ho do you calculate final temperature? anyone please help thanks that's a little vague. Are you dealing with ideal gases? If so you would use the formula PV=nRT P = pressure V = volume of container n = moles (grams/molar mass) R = gas constant (0.0821) T =

    asked by shannon on March 15, 2007
  10. Physics

    A vector drawn 55 mm long represents a velocity of 25 m/s. How long should you draw a vector to represent a velocity of 17 m/s? please help me!! 55mm is to 25m/s as X is to 17m/s...maybe? thanks..i tried that and the answer was wrong...these questions are

    asked by Katelyn on September 26, 2006
  11. Chemistry

    The age of a rock can be estimated by measuring the amount of 40Ar trapped inside. The calculation is based on the fact that 40K decays to 40Ar by a first-order process. It also assumes that none of the 40Ar produced by the reaction has escaped from the

    asked by Matt on May 21, 2009
  12. global science

    Michael Phelps won the 100 meter butterfly, Phelps swam 100 meters in 50.58 seconds. the 2nd place swimmer swam the 1oo meters in 50.59 seconds. Phelps beat him by 1/100th of a second. Calculate, in inches, the distance Phelps beat Cavic by

    asked by Anonymous on September 7, 2010
  13. math

    A military jet flies directly over and at a right angles to the straight line course of a commercial jet. The military jet is flying 200 mph faster than four times the commercial jet. How fast is each going if they are 2050 miles apart (on a straight line)

    asked by lee on September 24, 2010
  14. MATH-Help!

    A new set of car tires has a tread depth of 8 millileters. The tread depth decreases 0.12 millimeter per thousand miles driven. Write an equation that gives the tread depth as a function of the distance driven. Then predict what distance the tread depth

    asked by Sara on September 23, 2014
  15. Math

    Daniel drives 30 mph to the toy store and 45 mph back home, taking the same route both ways. If the total trip took two hours, how many total miles does he drive on the round-trip from home to the store and back? Can you please explain how to do it?

    asked by Gina on July 13, 2016
  16. Pre-Algebra Checkk

    1. Convert the rate using dimensional analysis. 30 miles/hour = _______ feet/second a. 0 b. 44 c. 43 d. 2 answer: b 2. Convert the rate using dimensional analysis. 16 feet/second = _____ yards/minute a. 240 b. 120 c. 10 d. 320 answer: b Can someone check

    asked by Cheryl on May 9, 2011
  17. Math

    Which equation describes the relationship between x and y in the table below? x y 5 20 7 28 9 36 11 44 A.y=x+15 B.y=x+8 C.y=3x+5 D.y=4x 14.Henry rides his bike 6 miles every 4 days. At that rate how far will Henry ride his bike in 12 days? A.6 B.12 C.16

    asked by Jerald on March 23, 2013
  18. Algebra

    A new set of car tires has a tread depth of 8 millileters. The tread depth decreases 0.12 millimeter per thousand miles driven. Write an equation that gives the tread depth as a function of the distance driven. Then predict what distance the tread depth

    asked by Riley on September 23, 2014
  19. College Algebra

    A train leaves New York for Boston, 200 miles away, at 3:00 P.M. and averages 70 mph. Another train leaves Boston for New York on an adjacent set of tracks at 4:00 P.M. and averages 55 mph. At what time will the trains meet? (Round to the nearest minute.)

    asked by Sarah on October 12, 2015
  20. Math

    A new set of car tires has a tread depth of 8 millileters. The tread depth decreases 0.12 millimeter per thousand miles driven. Write an equation that gives the tread depth as a function of the distance driven. Then predict what distance the tread depth

    asked by Collins on September 23, 2014
  21. calculus

    A military jet flies directly over and at a right angles to the straight line course of a commercial jet. The military jet is flying 200 mph faster than four times the commercial jet. How fast is each going if they are 2050 miles apart (on a straight line)

    asked by lee on September 24, 2010
  22. physics

    Two identical small spherical conductors (point charges), separated by 0.6 m, carry a total charge of 200 mu or micro CC. They repel one another with a force of 120 N. (For the universal constant k use the value 8.99 times 109 N m2/C2.) I think i am

    asked by jasmine on September 1, 2014
  23. chem

    I'm suppose to calculate the weight percent per volume (grams pre 100cm3) of ethanoic acid in a commercial sample of vineger from the following: (a) 0.4321g of pure momoprotic acid( formula weight 204.2 amu) required 23.45cm3 of naoh for neutralizalion.

    asked by hammie on February 13, 2012
  24. Why so much school

    Can anyone help me?? Suppose Ann’s bread recipe calls for 900 g of flour, 0.68 kg of sugar, 145 mg of salt, and 185 mg of baking powder. Her scale measures grams only. How can she convert each of the ingredients to equivalent measures in grams? Dont give

    asked by Pedro on October 2, 2017
  25. Chemistry

    What properties explain the behavior of liquid-filled thermometers? Liquids expand upon heating and contract upon cooling. thanks.. What are the two reference temperature on the Celsius Scale? Freezing point of water is 0o C and boiling point is 100o C. I

    asked by Dennis on January 19, 2007
  26. Trig - Identies/equation, please help!

    2Sin(Θ+47°)=1 ΘЄ[0°, 360°) What I did: Sin(Θ+47°)=1/2 Sin 1/2 = Θ+47° 30°+360 = Θ+47° 343° = Θ Ok, so how do i find the other solutions? In this problem its 103°. I think we were suppose to do something with the graphing calculator and

    asked by James on November 12, 2008
  27. Calculus

    I am confused on how to solve this problem : $5000 is invested for 4 years at 7% per annum compound interest. a. what will the amount be at the end of this period? b. what is the expression for the value of the investment after n full years? c. the

    asked by Jess on February 15, 2007
  28. Algebra

    The number of medical doctors D (in thousands) in the United States from 1998 through 2006 can be modeled by D = 431.61 + 121.8t, 8 ¡ t ¡ 16 where t represents the year, with t = 8 corresponding to 1998.¢Ó (a) In which year did the number of medical

    asked by Kristi on September 8, 2012
  29. Math word gr 8

    For the month of January, the average afternoon temperature in Calgard is 1/4 the average morning temperature. The average afternoon temperature is -4 C. What is the average morning temperature? a.) If m represents the average morning temperature, what

    asked by Tyler on January 26, 2009
  30. chemistry

    A balanced equation that represents an overall cell reaction is shown. Choose the cell notation which corresponds to the electrochemical cell that is described by this equation. a) Sn2+(aq) + 2Cu+(aq) → Sn4+(aq) + 2Cu(s) b) Pt(s) l Sn2+(aq), Sn4+(aq) ll

    asked by Bob, NEED YOUR HELP on November 15, 2011
  31. Math

    Write the equation and solve the following problems 1. Seven more then three times a number is 22. What is the number? 2. One half a number diminished by six is 14. What is the number? 3. The sum of two consecutive numbers is 131. What are the numbers. 4.

    asked by Mileena on April 3, 2017
  32. Chemistry

    Surface: Ea(kj/mol): Tungsten 248 Platinum 331 Copper 204 A decomposition reaction was studied on three different surfaces. The activation energy on each surface is shown in the table. Which surface represents the best heterogeneous catalyst if the

    asked by Ramon on March 23, 2018
  33. Physics

    A neutron collides elastically with a helium nucleus (at rest initially) whose mass is four times that of the neutron. The helium nucleus is observed to rebound at an angle '2 = 41° from the neutron's initial direction. The neutron's initial speed is 5.6

    asked by micole on May 30, 2007
  34. Physics

    In the experiment, a meter is hooked up to a speaker to monitor the amplitude of the received sound. Suppose the background signal level is 15 mV, the signal is 90 mV with no attenuator and is 30 mV with an attenuator in place. Calculate pt/pi including

    asked by Michael on November 28, 2011
  35. Statistics

    suppose a random sample of 360 students is drawn form a population of students. Among sampled, the average IQ score is 12 with standard deviation of 3. What is the upper confidence limit of the 95% confidence interval of the population

    asked by Arona Basuti on March 14, 2012
  36. Calculus

    Suppose oil spills from a ruptured tanker and spreads in a circular pattern. If the radius of the oil spill increases at a constant rate of 2m/s, how fast is the area of the spill increasing when the radius is 15m?

    asked by Web7 on November 2, 2011
  37. Physics

    In the experiment, a meter is hooked up to a speaker to monitor the amplitude of the received sound. Suppose the background signal level is 15 mV, the signal is 90 mV with no attenuator and is 30 mV with an attenuator in place. Calculate pt/pi including

    asked by Michael on November 16, 2011
  38. Math-Please Help

    20. Suppose a population of 175 crayfish doubles in size every month. The function f(x)=175(2^x) gives the population after x months. How many crayfish will there be after 1 year? A) 2,100 B) 4,200 C) 716,800 D) 61,250 I think the answer is D. Am I

    asked by Nightcore on April 26, 2017
  39. physics

    Suppose that on earth you can throw a ball vertically upward a distance of 2.39 m. Given that the acceleration of gravity on Mars is 3.80 m/s2, how high could you throw a ball on Mars? (Take the y-axis in the vertical direction, and assume that the

    asked by octavia on January 31, 2013
  40. statistics

    On standard IQ tests, the mean is 120 and the standard deviation is 15. The results are very close to fitting a normal curve. Suppose an IQ test is given to a very large group of people. Find the percent of people whose IQ score is less than 120.

    asked by Anonymous on February 16, 2012
  41. physicsssss

    Suppose that the magnetic field in the figure below has a magnitude of 1.1 T, the rod has a length of 0.83 m, and the hand keeps the rod moving to the right at a constant speed of 3.8 m/s. If the current in the circuit is 0.045 A, what is the average power

    asked by purplegoddess on March 23, 2013
  42. Physics

    A 22 kg suitcase is being pulled with constant speed by a handle that is at an angle of 23 ∘ above the horizontal. If the normal force exerted on the suitcase is 150 N , what is the force F applied to the handle? I don't understand how the equations are

    asked by J on June 16, 2016
  43. BIO. LIFE SCIENCE

    IN GARDEN PEAS, THE ALLELE FOR TELLOW PEAS IS DOMINATE T OTHE ALLELE FOR GREEN PEAS. SUPPOSE YOU HAVE A PLANT THAT PRODEUCES YELLOW PEAS, BUT YOU DON'T KNOW WHETHER IT IS HOMOZYGOUS DOMINANT OR HETEROZYGOUS. WHAT EXPERIMENT COULD YOU DO TO FIND OUT?

    asked by DREW on May 12, 2010
  44. Standard Deviation

    On standard IQ tests, the mean is 100 and the standard deviation is 16. The results are very close to fitting a normal curve. Suppose an IQ test is given to a very large group of people. Find the percent of people whose IQ score is more than 100.

    asked by Anonymous on February 14, 2012
  45. Algebra II

    You have purchased a VCR for $180. You also joined a video rental store where you can rent movies for $3 each. Suppose that the cost of admission to a movie theater is $6.00. How many videos must you rent to make your average cost per video less than

    asked by Anonymous on December 2, 2012
  46. Physics

    You drop a rock into a deep well. You can't see the bottom of the well but you can hear the impact after T seconds. Suppose the speed of sound is c feet per second and the depth of the falling rock at time t is gt^2/2 feet. Compute the depth d of the well.

    asked by Anon on January 26, 2017
  47. Algebra II

    You have purchased a VCR for $180. You also joined a video rental store where you can rent movies for $3 each. Suppose that the cost of admission to a movie theater is $6.00. How many videos must you rent to make your average cost per video less than

    asked by Anonymous on December 2, 2012
  48. chemistry

    Suppose you have two 100-mL graduated cylinders. In each cylinder there is 40.0mL of water. You also have two cubes: one is lead(11.3g/ml), and the other is aluminum(2.70g/ml) Each cube measures 2.0cm on each side. After you carefully lower each cube into

    asked by k on September 2, 2014
  49. calculus

    Suppose oil spills from a ruptured tanker and spreads in a circular pattern. If the radius of the oil spill increases at a constant rate of 3m/s, how fast is the area of the spill increasing when the radius is 15m?

    asked by mariska on October 29, 2013
  50. STATS

    Suppose we are testing the null hypothesis H0: ì = 20 and the alternative Ha: ì 20, for a normal population with ó = 5. A random sample of 25 observations are drawn from the population, and we find the sample mean of these observations is = 17.6. The

    asked by Tracy on April 5, 2014
  51. Math

    You drop a rock into a deep well. You can't see the bottom of the well but you can hear the impact after T seconds. Suppose the speed of sound is c feet per second and the depth of the falling rock at time t is gt^2/2 feet. Compute the depth d of the well.

    asked by Jamie on January 26, 2017
  52. physics

    A vibration platform oscillates up and down with an amplitude of 8.8 cm at a controlled variable frequency. Suppose a small rock of unknown mass is placed on the platform. At what frequency will the rock just begin to leave the surface so that it starts to

    asked by Katie on March 23, 2012
  53. Personal Finance

    Suppose you buy a two-year CD for $10,000 from First Command Bank. Assume monthly compounding. Use the APR from the below Table 4.1 and the compound interest formula to determine how much interest the CD earns for you at maturity. The Table says APR is

    asked by Kinsey on June 20, 2016
  54. Math-Help please?

    Michael owns 300 shares of a certain stock. Suppose the price of the stock drops by $4 per share. Write a multiplication equation to find the change in Michael's investment. I put 300x(300x[-4]) is that right?

    asked by Anna on November 14, 2011
  55. math

    Suppose that people's heights (in centimeters) are normally distributed, with a mean of 175 and a standard deviation of 6. We find the heights of 40 people. (a) How many would you expect to be between 169 and 181 cm tall? 127 27 (b) How many would you

    asked by apryl on September 7, 2011
  56. Statistics

    Suppose that out of 15,351 convicts who escaped from U.S. prisons, only 7667 were recaptured. Let p represent the proportion of all escaped convicts who will eventually be recaptured. Find a point estimate for p. Round your answer to four decimal places.

    asked by Desperate on July 8, 2012
  57. philosophy

    I am suppose to write a paper on ethical dilemma.I was thinking about writing about a woman who works in retail sales and a customer gives her to much change. I was thinking that would be an ethical dilemma. I was wondering what anybody thinks. I really

    asked by ANGELA on January 30, 2013
  58. mRNA

    sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids that would be formed

    asked by Nghia on October 29, 2011
  59. Physics

    Suppose that the amount of heat removed when 2.9 kg of water freezes at 0.0 oC were removed from ethyl alcohol at its freezing/melting point of -114.4 oC. How many kilograms of ethyl alcohol would freeze? I don't know where to start with this question!

    asked by Cindy on February 2, 2015
  60. Trig(I think)

    Suppose oil spills from a ruptured tanker and spreads in a circular pattern. If the radius of the oil spill increases at a constant rate of 1m/s, how fast is the area of the spill increasing when the radius is 30m?

    asked by Kelly on April 29, 2013
  61. Astronomy

    Suppose that, in the future, observations with some new telescope reveal a planet about 16 AU from a star whose mass is the same as our sun's mass. How long does it take the planet to orbit the star? Use Keplers law. You know at 1AU the period is 365

    asked by Roger on April 3, 2007
  62. sci 207

    Geologists are responsible for identifying and mapping mineral resources. But mineral resources are buried below the soil and covered with vegetation. How do you suppose geologists in the field find clues about the distribution of rock types?

    asked by tamika on July 6, 2011
  63. Math for Computer Science

    Suppose the domain of the propositional function P(x, y) consists of pairs x and y, where x = 1, 2, or 3, and y = 1, 2, or 3. Write out the propositions below using disjunctions and conjunctions only. ∃x∀y ¬P(x, y) The above is equivalent to

    asked by Kid on September 26, 2018
  64. College Chemistry

    I think this should be easy but im stuck. Please help: Suppose a compound could point in any of two directions in the solid and still have the same energy. How many molecules would there be if the total entropy of a solid sample of this compound was

    asked by Jude on May 1, 2011
  65. Statistics

    "Suppose two independent samples have been collected.Based on a sample of 26 from the first population, you observe 14 successes. The second sample of size 26 had 17 successes. What is the critical value for a 85% confidence interval that compares these

    asked by Chris on November 5, 2016
  66. Physics

    A vibration platform oscillates up and down with an amplitude of 10.2 cm at a controlled variable frequency. Suppose a small rock of unknown mass is placed on the platform. At what frequency will the rock just begin to leave the surface so that it starts

    asked by Phil on February 19, 2012
  67. World History

    Rome’s empire covered 2.5 million square miles (1). But this large territory meant longer frontiers to defend and more lands to control (2). To flesh out the army’s dwindling ranks, Roman Senators declared that all able-bodied men must serve, which

    asked by malia on October 1, 2017
  68. Science

    1. White skin (W) is dominant over yellow skin (w) in chickens. Which of the following genotypes would result in a white-skinned chicken that could possibly have yellow-skinned offspring? A. WW B. Ww** C. ww 2. Which of the following describes the genotype

    asked by Mimmi on October 7, 2015
  69. physics

    A 88-kg astronaut and a 1200-kg satellite are at rest relative to the space shuttle. The astronaut pushes on the satellite, giving it a speed of 0.25m/s directly away from the shuttle. Seven-and-a-half seconds later the astronaut comes into contact with

    asked by ash on August 20, 2011
  70. Pre-Calc College

    Two 5-grain aspirin tablets contain 650 mg of the drug. With aspirin's half-life of 29 minutes, how much is left in the bloodstream after 2 hours? How long does it take for the level to be equivalent to 10 mg of aspirin? If an individual takes two tablets

    asked by Paige on May 16, 2016
  71. math

    Uncle Albert's estate is to be divided among his three nephews. The will specifies that Daniel receive one-half of the amount that Brain receives and that Raymond receive $1,000 less than one-third of the amount that Brain receives. If the estate amounts

    asked by jamie lynn on June 13, 2012
  72. Chem 152

    Given the measured cell potential, E cell is -0.3603 V at 25°C in the following cell, calculate the H+ concentration Pt(s)|H2(g,0.713 atm)|H+(aq, ? M)||Cd2+(aq 1.00 M)|Cd(s) The balanced reduction half-reactions for the cell, and their respective standard

    asked by Mo on December 12, 2018
  73. math

    The distance between two towns P and Q is 390 km. John left town P at 7:30 am and travelled towards town Q at an average speed of 60 km/hr. Half an hour later Patrick left town Q and travelled towards town P at the same speed. At what time did they meet? *

    asked by kelvin on September 4, 2017
  74. Physics

    If a magnetic flux passes through a circular coil when its diameter D, what should be its diameter (in terms of D) so that only half as much flux passes through it in the same field? Assume that the magnetic field is uniform over the area in both cases. I

    asked by J on March 3, 2008
  75. World History

    What impact did Emperor Constantine's establishment of the “New Rome” (Constantinople) have on the Roman Empire? A.The expense of building the new city impoverished the later Empire. B. The pope moved his headquarters from “Old Rome” to “New

    asked by Laura on November 7, 2013
  76. Chemistry

    Balance the following equation for a half reaction that occurs in acidic solution. Use e– as the symbol for an electron. U^4+ --> UO2^+ There is a hint: In acidic solution, you may add H2O and H as needed to balance oxygen and hydrogen. When finished,

    asked by Clueless on April 28, 2014
  77. Math

    A restaurant owner has a luncheon special that consists of a cup of soup, half of a sandwich, and a beverage. She wants to advertise that a different luncheon of three items can be purchased 365 days of the year for $4.99 apiece. If she has 7 different

    asked by Jeremy on February 26, 2012
  78. chemistry

    mole creative assignment RAFT writing my raft is that i am mole, i am writing to periodic table, the rap song is a form will i take and explain how to find molar mass. using theese things i have to write half page paragraph but i don't know how start my

    asked by anmol on October 11, 2011
  79. Calculus

    Mr. Phillips decides to have a completely fenced-in garden. It will be laid out so that one side is adjacent to his neighbor's property. The neighbor agrees to pay for half of that part of the fence which will border his property. The garden is to contain

    asked by MEG on November 15, 2010
  80. algebra. help!

    The ordered pairs (1,2),(2,4),(3,8),(4,16), and (5,32) represent a function? a. y=x^2 b. y=2x c. y=2^x d. y=x+2****** The ordered pairs (1,16),(2,25),(3,36),(4,49), and (5,64) represent a function. What is a rule that represents this function? a. y=x^2 b.

    asked by Nikky on November 13, 2014
  81. math

    In a lawn, there is a patch of clover. Every week, the patch doubles in size. If it takes 12 weeks for the patch to cover the entire lawn, how long would it take for the patch to cover half of the lawn?

    asked by Anonymous on August 1, 2012
  82. math

    The volume of ice-cream in the cone is half the volume of the cone. The cone has a 3 cm radius and height of 14 cm. What is the depth of the ice-cream, correct to 2 decimal places? Answer = 11.11

    asked by anonymous on February 22, 2018
  83. Science

    Oregon and Washington generate far more hydro-electric power than most states. How does all this hydro-electric power help keep our electric bills low (half the cost of electricity in many states)?

    asked by Kaai97 on June 11, 2016
  84. math

    how do i work out the following word problem. a particular ball retains half of its heght on each bounce when dropped from a height of 80 m. give the height of the ball on the fifth bounce after being dropped?(will the ball comes to rest?)

    asked by ladane on May 19, 2012
  85. Algebra

    Two different radioactive isotopes decay to 10% of their respective original amounts. Isotope A does this is 33 days, while isotope B does this in 43 days. What is the approximate difference in the half-lives of the isotopes? 3 days 10 days 13 days 33 days

    asked by Junior on July 14, 2014
  86. math

    Phosphorus-32 (P-32) has a half-life of 14.2 days. If 200 g of this substance are present initially, find the amount Q(t) present after t days. (Round your growth constant to four decimal places.) How fast is the P-32 decaying when t = 21.5? (Round your

    asked by Vanessa on April 5, 2014
  87. math

    Phosphorus-32 (P-32) has a half-life of 14.2 days. If 200 g of this substance are present initially, find the amount Q(t) present after t days. (Round your growth constant to four decimal places.) How fast is the P-32 decaying when t = 21.5? (Round your

    asked by vanessa on April 7, 2014
  88. Physics

    A 97kg astronaut and a 1100kg satellite are at rest relative to the space shuttle. The astronaut pushes on the satellite, giving it a speed of 0.13m/s directly away from the shuttle. Seven and a half seconds later the astronaut comes into contact with the

    asked by Arr-chan on May 27, 2014
  89. Math in Science

    A rock containing a newly discovered fossil is found to contain 5 mg of an unstable form of potassium and 5 mg of the stable element formed from its decay. If the half-life of the unstable form of potassium is 1.3 billion years, how old is the rock? What

    asked by Janey on November 7, 2013
  90. Math

    Phosphorus-32 (P-32) has a half-life of 14.2 days. If 200 g of this substance are present initially, find the amount Q(t) present after t days. (Round your growth constant to four decimal places.) How fast is the P-32 decaying when t = 21.5? (Round your

    asked by Vanessa on April 7, 2014
  91. Math

    Phosphorus-32 (P-32) has a half-life of 14.2 days. If 200 g of this substance are present initially, find the amount Q(t) present after t days. (Round your growth constant to four decimal places.) How fast is the P-32 decaying when t = 21.5? (Round your

    asked by Vanessa on April 6, 2014
  92. math

    Marco jumped rope for 20 more seconds than Troy. The letter r represents the number of minutes that Troy jumped rope. Which expression shows the number of minutes that Marco jumped rope?

    asked by brianna on May 5, 2014
  93. math

    In a cupboard there are pencils, rulers and books. The number of pencils is 15 more than that of rulers. The number of books is three times that of rulers. If the number of pencils is p,write the equation to represents the total number of items in the

    asked by king on January 9, 2015
  94. Math

    Mike drank more than half of his glass of juice. What fraction of juice could mike have drank?

    asked by Anonymous on March 23, 2016
  95. math

    the first term of a sequence of numbers is 4. each term after the first is 4 more than half the preceding term, what is the fourth term of the sequence?

    asked by peter on June 14, 2010
  96. math

    there are 63 animals. 2 are horses .there 5 more chickens than 3 times the pigs. there are 2 less chickens than half pigs times 7

    asked by firn on November 12, 2016
  97. Calculus

    Find a such that the volume inside the hemisphere and inside the cylinder one half the volume of the hemisphere

    asked by Dummy on March 12, 2013
  98. Music

    1. How many beats does a sixteenths note have? one half one quarter*** 1 3 2. A quarter note can be divided into how many sixteenths? 4 8 6 2*** Please help me!

    asked by Please Help!! on February 5, 2019
  99. math

    Twice the sum of two numbers exceed three times their difference by 8, while half the sum is one more than the difference. What are the numbers?

    asked by Marie on November 18, 2015
  100. math

    if less than half of the garden is planted with corn, then is it reasonable to estimate that 5/6 of the garden is planted with corn?

    asked by amy on April 8, 2013