1. dna strands/sequences

    The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC

    asked by notasciencegal on October 22, 2006
  2. chemistry

    To prepare the titrant fo amonia nitrogen analysis an analyst weight out 1.20 grams of concentration 98% sulfuric acid and brings to 1000 ml in lab pure water. if the molecular weight is 98 calculate the normality of the solution this analyst has prepare.

    asked by Faye on March 26, 2011
  3. Qualitative analysis

    X is a solution containing both sodium chloride and sodium sulfate. Three of the following solutions will produce a white precipitate on addition of X. Which one remains clear? A) Aqueous ammonia C) Lead(ll) nitrate B) Barium chloride D) Silver nitrate

    asked by Cheezel on November 17, 2016
  4. Physics

    When the rubber band in a slingshot is stretched, it obeys Hooke's law. Suppose that the "spring constant" for the rubber band is k = 53 N/m. When the rubber band is pulled back with a force of 7.3 N, how far does it stretch? F=kx solve for x.

    asked by Mary on March 29, 2007
  5. math: permutations

    Hi, I need your help. I just cant figure out how to solve this problem. Question: There are two rows of chairs. The first row has two chairs and the second row has four chairs. In how many ways can six people be seated if a couple from the group must sit

    asked by Aina on July 24, 2016
  6. pre algebra

    Mr Chee deposited $80 into his checking account. Then, after writing a $23 check for gas and a $90 check for his child's day care, the balance in his account was $67. How much was in his account before he made the deposit? How would you solve and check the

    asked by Amber shall on February 1, 2011
  7. World History (Ms. Sue)

    Which country do you think had a stronger democracy at the end of the nineteenth century, France or England? Why? A: I think England had a stronger democracy at the end of the nineteenth century. By 1870, England, or Great Britain, had long had a working

    asked by Victoria on October 20, 2014
  8. English

    1. Animals give out information and show their feelings in different ways. (What is the meaning of 'give out' here? What other expressions can we use instead of 'give out'? Is it 'distribute'?) 2. Bees dance and tell other bees where to find food. (What is

    asked by rfvv on December 17, 2009
  9. Math

    Find the area of the triangle with the base 1 2/5 yards and height 5/9 yards. The area of the triangle equals half of the product base and height. The area is ____yd^2 (Type whole number or a simplified fraction) I came up with 35/108 did I do the math

    asked by Denise on August 6, 2013
  10. Math

    I need help on two problems I would like if you went step by step with the problem with me and then let me figure out the answer. If, Tonya and Toya have $15.25 together and Tonya had 25 cents more than Toya, how much does each have? Second question: Bruce

    asked by hip hop chic on August 29, 2005
  11. Physics

    High-speed stroboscopic photographs show that the head of a golf club of mass 231g is traveling at 59.0m/s just before it strikes a 47.1g golf ball at rest on a tee. After the collision, the club head travels (in the same direction) at 44.3m/s. Calculate

    asked by zhang135 on October 13, 2014
  12. Technology

    1. Which of the following is NOT an example of a objective question? A. multiple choice B. essay** C. true/false D. matching 2. Why is it important to recognize the key word in an essay question? A. It will provide the answer in an essay B. It will show

    asked by Laurie on February 9, 2016
  13. physics

    High-speed stroboscopic photographs show that the head of a golf club of mass 230g is traveling at 56.1m/s just before it strikes a 44.6g golf ball at rest on a tee. After the collision, the club head travels (in the same direction) at 41.4m/s. Calculate

    asked by lyn on October 24, 2017
  14. Please help me solve this - PreCalc

    Use identities to find the exact value of the trigonometric expression below. 1/cos2 * π/16 - 1/cot2 * π/16 PS: in words, the problem is, one divided by cosine-squared, then beside the cosine-square (still in the denominator) is pi/16. Minus one divided

    asked by chizoba on July 25, 2016
  15. physics

    High-speed stroboscopic photographs show that the head of a golf club of mass 230g is traveling at 56.1m/s just before it strikes a 44.6g golf ball at rest on a tee. After the collision, the club head travels (in the same direction) at 41.4m/s. Calculate

    asked by faith on October 24, 2017
  16. math

    find the constant of proportionality and unit rate for the data in the table. Then write the equation to represent the relationship between time t and distance d Time Distance 2 t 90 miles 3 hrs 135 miles 5 hrs 225 miles 6 hrs 270 miles i need to show how

    asked by Natasha on April 4, 2017
  17. physics

    High-speed stroboscopic photographs show that the head of a golf club of mass 230g is traveling at 56.1m/s just before it strikes a 44.6g golf ball at rest on a tee. After the collision, the club head travels (in the same direction) at 41.4m/s. Calculate

    asked by Jelaa on October 24, 2017
  18. math

    i have this question and im not sure how to do it i keep getting stuck with these types of questions and i would appreciate some help (a) The rate of decay of a radioactive substance, S, is proportional to the amount remaining, x. Given that x = a at time

    asked by jemmy on December 16, 2009
  19. Physics

    On a frozen pond, a 11.7 kg sled is given a kick that imparts to it an initial speed of v0 = 2.01 m/s. The coefficient of kinetic friction between sled and ice is μk = 0.111. Use the work kinetic energy theorem to find the distance the sled moves before

    asked by Anonymous on March 16, 2016
  20. physics

    A black and tackle with a velocity ratio of 5 is used to raise a mass of 25kg through a vertical distance of 40cm at a steady rate.if the effort is equal to 60N, determine a. The distance moved by the effort b. The work done by the effort in lifting the

    asked by abubakar on March 7, 2015
  21. physics

    A 64.9 kg skier coasts up a snow-covered hill that makes an angle of 25.4° with the horizontal. The initial speed of the skier is 8.67 m/s. After coasting a distance of 1.92 m up the slope, the speed of the skier is 4.33 m/s. Calculate the work done by

    asked by Fallon on May 11, 2010
  22. Physics

    A 61.8 kg skier coasts up a snow-covered hill that makes an angle of 26.0° with the horizontal. The initial speed of the skier is 6.10 m/s. After coasting a distance of 1.86 m up the slope, the speed of the skier is 4.48 m/s. Calculate the work done by

    asked by Fallon on April 29, 2010
  23. physics

    A 64.9 kg skier coasts up a snow-covered hill that makes an angle of 25.4° with the horizontal. The initial speed of the skier is 8.67 m/s. After coasting a distance of 1.92 m up the slope, the speed of the skier is 4.33 m/s. Calculate the work done by

    asked by Fallon on May 9, 2010
  24. physics

    A body of mass 5.0kg slides from rest down a plane inclined at 30degrees to the horizontal. After sliding 12m down the plane it is found to have a speed of 10m/s. a) How much work has been done in overcoming friction along the plane? b) Calculate the

    asked by sand on June 13, 2012
  25. physics

    A small 2g plastic ball is suspended by a 20 cm long string in a uniform electric field. If the ball is in equilibrium when the string makes a 15 degree angle with the vertical, what is the net charge on the ball? E=10^3 N/c(answer: 5.25x10^-6) Work: I

    asked by Anonymous on February 11, 2008
  26. physics

    On a frozen pond, a 13.2 kg sled is given a kick that imparts to it an initial speed of v0 = 2.48 m/s. The coefficient of kinetic friction between sled and ice is μk = 0.123. Use the work kinetic energy theorem to find the distance the sled moves before

    asked by Joe on February 18, 2012
  27. Physics

    1. A steam engine converts 150 kg of water completely to steam. The process involves transfer of 4 x 10^8 J as heat. If steam escaping through the safety valve does 2 x 10^8 J of work against outside atmosphere, the net change in the internal energy is: a.

    asked by Isabella on December 21, 2015
  28. physics

    A father pulls his young daughter on a sled with a constant velocity on a level surface through a distance of 10 m, as illustrated below. If the total mass of the sled and the girl is 35 kg and the coefficient of kinetic friction between the sled runners

    asked by Anonymous on April 11, 2010
  29. Physics

    A 60kg softball player, who is 1.75m tall, performs 12 repetitions of a 140kg squat. If there is a 1m chance from the starting position to the bottom position, how much work is accomplished during the entire set? How much potential energy is stored at the

    asked by ljp33 on August 6, 2013
  30. physics

    On a frozen pond, a 13.9 kg sled is given a kick that imparts to it an initial speed of v0 = 1.81 m/s. The coefficient of kinetic friction between sled and ice is μk = 0.122. Use the work kinetic energy theorem to find the distance the sled moves before

    asked by taylor on October 6, 2016
  31. P.E

    What is a tactic in basketball and how does it work ? The word "tactic" just means a plan or a strategy. http://dictionary.reference.com/search?q=tactic&x=0&y=0 So ... who comes up with plans or strategies or tactics for players to use in a game? Who

    asked by DEBoRAH on September 3, 2006
  32. Honors Chemistry

    If 72.4 kJ of heat is supplied to a 752 g block of metal, the temperature of the metal increases by 9.95°C. Calculate the specific heat capacity of the metal in J/g·°C. I cannot find the information in my textbook, and I don't understand the equation

    asked by Elisheva on July 21, 2014
  33. Physics 1

    A 64.9 kg skier coasts up a snow-covered hill that makes an angle of 25.4° with the horizontal. The initial speed of the skier is 8.67 m/s. After coasting a distance of 1.92 m up the slope, the speed of the skier is 4.33 m/s. Calculate the work done by

    asked by Fallon on May 5, 2010
  34. Physics (Work Problem)

    A 25kg box is pulled across a frictionless floor by a rope that is inclined 30 degrees above horizontal. The tension in the rope is 50N. How much work is done by the force in moving the crate 10 meters? If the box started at rest, what is the final

    asked by James T. on November 12, 2014
  35. Math

    If I were to make an equation so that the left side were a reciprocal function and the right side were an absolute value function, then the equation would be guaranteed to have at least one solution. Why?

    asked by Mikala on January 2, 2017
  36. math

    The equation 1/14 (196x+17-10)=______ (20x+12x) has no solution. The equation (4x+24/122)=_____ (x+16/122) Im sure the answer for the second one is 4, (4x+24/122) = 4 (x+16/122)

    asked by Steve on May 7, 2016
  37. 5th grade math (word problems)

    Stefan pours 5/8 cup of milk. He uses 2/3 of it for a bowl of cereal. What fraction of a cup of milk does he use with his cereal? solution: 5/8 * 2/3 = 10/24 = 5/6. So, is the answer 5/6?

    asked by Alex on April 7, 2013
  38. Algebra

    If I were to make an equation so that the left side were reciprocal function and the right side were an absolute value function then the equation would be guaranteed to have at least one solution. Why?

    asked by Joe on January 2, 2017
  39. Chem

    Determine the concentration of a dioxin solution whose percent absorbance is 0.40% This is the resulting: Absorbance Dioxin 0.64 5.5 0.76 6.3 1.0 8.0 But why can't I figure out the concentration whose percentage is .40%?

    asked by Stacey on March 31, 2010
  40. math

    The equation 1/14 (196x+17-10)=______ (20x+12x) has no solution. The equation (4x+24/122)=_____ (x+16/122) Im sure the answer for the second one is 4, (4x+24/122) = 4 (x+6/122)

    asked by Steve on May 7, 2016
  41. Intermediate Algebra

    Please Help!! Use the discriminant to determine whether the follow equations have solutions that are: -two different rational solutions -two different irrational solutions -exactly one rational solution or -two different imaginary solutions. 8x^2+7x+3=0

    asked by ladybug on June 13, 2012
  42. Chemistry

    35.0mL of 0.050 M HCl is titrated with 0.050 M NH3 (Kb= 1.8 x 10^-5). The pH of the analyte solution after 15.0mL addition of NH3 titrant is?

    asked by Eliza on April 11, 2017
  43. Chemistry

    What volume of concentrated sulfuric acid (20% weight/weight, density = 1.14) is needed to prepare 1 L of a 0.5 N solution of sulfuric acid?

    asked by Caroline on February 11, 2018
  44. science

    is salad dressing - homogenous or heterogenous if it is homogenous is it solution or colloids 8th grade science " just says salad dressing"

    asked by liz on October 5, 2007
  45. Algebra

    If you replace the equal sign of an equation and put an inequality sign in its place, is there ever a time when the same value will be a solution to both the equation and inequality?

    asked by Diana on May 27, 2010
  46. Biology

    Write a brief description of the procedure required to make 10mL each of 2 M, 1.5 M, and 1 M NaCl solution from a 2 M Stock NaCl. Write the description.

    asked by Debbie on September 23, 2012
  47. chemistry

    How can you separate Ag+, Bi3+, Ni2+ in a solution? I am suppose to make a flow chart... would i use HCL to separate Bi3+ and Ag+ from Ni2+?

    asked by Marie on November 7, 2011
  48. chemisrty

    the ph of a 4.0 mol/L solution of hydrogen fluoric acid is 3.0 is this a concentrated or diluted explain I believe it is concentrated because 3.0 is higher then 0.5 mol/L but it can also be diluted

    asked by Anonymous on April 7, 2016
  49. chemistry

    What concentration of the barium ion,Ba^2+ ,must be exceeded to precipitate BaF2 from a solution that is 1.00*10^-2M in the fluoride ion,F-? Ksp for barium fluoride is 2.45*10^-5.

    asked by roshan on March 16, 2011
  50. Chemistry

    A lactic acid/lactate ion buffer solution contains 0.19 M HC3H5O3 and 0.78 M C3H5O3-, respectively. The Ka value of lactic acid is 1.4*10^-4. Calculate the pH of this buffer.

    asked by Lynne on June 5, 2010
  51. Algebra

    Kevin ran 4 miles more than Steve ran. The sum of their distances is 26 miles. How far did Steve run? The domain of the solution is {0, 4, 11, 22}.

    asked by Jd on August 21, 2014
  52. sciecnce (hypothesis)

    Am doing a experiement with a egg and trying to see if the shell dissolves hypothesis: If the solution is vinegar then the egg shell will dissolve. Is the hypothesis correct

    asked by karan on September 18, 2011
  53. chemistry

    What mass of NaCl is contained in 24.88g of a 15.00% by mass solution of NaCl in water? the answer is 3.73g but i don't know how to get this answer..

    asked by Alaine on October 3, 2012
  54. Statistics

    I have a problem understanding how to set this problem up and get a solution: Consider a binomial experiment with n = 10 and p = 0.10. a. Compute P(x less than or equal to 2). b. Compute P(x greater than or equal to 1).

    asked by Joseph on September 24, 2007
  55. ENGLISH

    I HAVE BEEN ASKED TO WRITE AN ARTICLE ABOUT FEMALE MOSQUITO, PROBLEMS CAUSED BY FEMALE MOSQUITO, SOLUTION TO THE PROBLEMS AND CONCLUSION.

    asked by priya on June 21, 2009
  56. maths

    the sides of a rectangle are given in centimeters up length 4x+3 down length x+ 6y,left width 3x+1 right width 4x-y. find x and y and area of the rectangle .solution 4x+3=x+6y . y=3x+3÷6 also 4x-y=3x+1.x=y+1

    asked by chimere on May 7, 2015
  57. CHEMISTRY

    Which is NOT a solution? 1 metal alloys, 2 ice in water, 3 sugar in water, 4 vinegar in water.......the answer is ice in water correct?

    asked by Mindy on November 11, 2011
  58. honors chem

    Calculate the number of moles of solute in each of the following solutions: Solution Moles of Solute 4.4 L of 1.00 M CuCl = mol? 3.2 L of 2.60 M K2S= mol?

    asked by Tif on April 29, 2013
  59. Math

    -x+5 < 1/x+3 The solution manual is my book shows this -x+5 - 1/x+3 < 0 -x^2 + 2x + 14/x + 3 < 0 (x+2.873)(x-4.873)/x+3 < 0 I understand everything except how the (-) sign from the -x^2 in the -x^2 + 2x + 14/x + 3 < 0 step disappeared in the

    asked by Anonymous on January 23, 2018
  60. Bio chem

    How many mL of 0.80 molar NaOH must be added to 20 ml of 0.40 of molar propionic acid, in order to produce a solution with a pH of 4.89? (PKa of propionic acid is 4.89.)

    asked by Scott on May 4, 2017
  61. Chemisty

    A solution contains 20g of C^6H^12O^6 in 250g of water. What is the freezing-point depression of the solvent? What is the Freezing point of the solvent?

    asked by Veronica on March 7, 2010
  62. chemistry

    The vapor pressure of pure water at 25 degrees Celsius is 23.77 mm Hg. What is the vapor pressure, in mm Hg, of water above a solution that is 1.5m glucose, C6H12O6?

    asked by Anonymous on December 11, 2011
  63. chemistry

    What concentration of the lead ion, Pb^{2+} , must be exceeded to precipitate PbCl2 from a solution that is 1.00 x 10^{-2} M in the chloride ion, Cl^- ? Ksp for lead chloride is 1.17×10−5 .

    asked by Anonymous on December 6, 2012
  64. Chemistry

    A certain indicator, HA, has a Ka value of 6.3 × 10-8. The protonated form of the indicator is blue and the ionized form is red. -What is the PKa of the indicator? -What is the color of the indicator in a solution with pH=5?

    asked by jjhjhhjhk on November 2, 2014
  65. chem-please help!!!!!

    when a 25.0 mL sample of an unknown acid was titrated with a 0.100 M NaOH solution. Determine Ka for the unknown acid. Volume NaOH = 25 mL; pH=8.25

    asked by Rosemary on October 18, 2010
  66. MATH!

    The equation 1/14 (196x+17-10)=______ (20x+12x) has no solution. The equation (4x+24/122)=_____ (x+16/122) Im sure the answer for the second one is 4, (4x+24/122) = 4 (x+6/122)

    asked by Steve on May 7, 2016
  67. CHEMISTRY

    Whats the pH of the solution which can be prepared by mixing same volumes of 0.5% NH4Cl and 0.25% KOH ? (K=1.8 * 10^-5) M(NH4Cl) 53.5 g/mol M(KOH)=56g/mol

    asked by Anonymous on February 12, 2013
  68. chemistry

    In a titration, 25.0 mL of KHP is titrated to the equivalence point with NaOH. The final solution volume is 45.5 mL. What was the volume of NaOH used in the titration? 25.0 mL 20.5 mL 70.5 mL 45.5 mL

    asked by yuliette on June 11, 2016
  69. Algebra

    Can someone help me with this question? Use the discriminant to determine whether the following equations have solutions that are:two different rational solutions: two different irrational solutions: exactly one rational solution: or two different

    asked by dani on April 25, 2010
  70. math

    Use the discriminant to determine whether the following equations have solutions that are: two different rational solutions; two different irrational solutions; exactly one rational solution; or two different imaginary solutions.8x2 + 2x + 4 = 0

    asked by carol on May 2, 2011
  71. algebra

    1. Kevin ran 3 miles less than Steve ran. The sum of their distances is 21 miles. How far did Steve run? The domain of the solution is {0, 10.5, 12, 18}.

    asked by Mariah on August 30, 2014
  72. Chmeistry

    A lactic acid/lactate ion buffer solution contains 0.19 M HC3H5O3 and 0.78 M C3H5O3-, respectively. The Ka value of lactic acid is 1.4*10^-4. Calculate the pH of this buffer.

    asked by Lynne on June 5, 2010
  73. math

    The equation 1/14 (196x+17-10)=______ (20x+12x) has no solution. The equation (4x+24/122)=_____ (x+16/122) Im sure the answer for the second one is 4, (4x+24/122) = 4 (x+16/122)

    asked by Steve on May 7, 2016
  74. Calculus

    The slope of the tangent line to a curve at any point (x, y) on the curve is x/y. What is the equation of the curve if (3, 1) is a point on the curve? A. x^2 + y^2 =8

    asked by Justin on July 8, 2019
  75. Math

    If you replace the equal sign of an equation and put an inequality sign in its place, is there ever a time when the same value will be a solution to both the equation and inequality?

    asked by Sharon on September 18, 2008
  76. History

    As a result of the publications of Bartolomé de Las Casas: A. Amerindian rights were recognized and respected. B. the encomienda system was established. C. Amerindians became more maltreated than before. D. the Spanish government was more attentive to the

    asked by Any on February 6, 2014
  77. Health last questions.

    Physical lines of defense include A. skin, cielia, and mucous membranes *** B. hair C. nails D. teeth When a doctor feels for lymph nodes, he is checking for A. inflammation *** B. shrinking C. pain D. sensitivity Your body can get antibodies from A.

    asked by Ann on March 11, 2015
  78. business

    For this assignment you are to imagine that you are part of a select marketing group. This select group has been asked to consider the Colorado City Convention and Visitors Bureau survey of 25 hotels in the local area. The survey is concerned with the

    asked by ron on August 2, 2010
  79. Chemistry--help!

    Given the equilibrium: HCN(aq) + H2O(l) ←→ H3O+(aq) + CN-(aq) ΔH >0; Ka = 4.0 x10-10 What happens to the concentration of hydrogen cyanide [HCN] when the following stresses are placed on the system at equilibrium? NaCl is added ---> Stays the Same but

    asked by Val on March 9, 2010
  80. Algebra with Applications

    Suppose an insurance agent offers you a policy that will provide you with a yearly income of $150,000 in 25 years. What is the comparable annual salary today, assuming an inflation rate of 4%?. (Round your answer to the nearest cent.) I think I would solve

    asked by Danielle on August 26, 2012
  81. Physics

    A cylinder with a valve at the bottom is filled with an ideal gas. The valve is now opened and some of the gas escapes slowly. The valve is then closed, after which the piston is observed to be at a lower position. Assume that the system is in thermal

    asked by Thomas Samuel Adams on November 21, 2010
  82. Chemistry

    1) Frank and Oswalt report a molar absorptivity of 4700 L mol^-1 cm^-1 for thiocyanatoiron(lll) ion. What absorbance would you expect for a soloution that it 1.0e-4 M in thiocyanatorion(lll) ion, if the path length is 1.00 cm? 2) At a given temperature,

    asked by Joe on February 19, 2013
  83. Physics

    1. A ball is launched from a cliff with an initial velcity of 10 m/s at an angle of 40 degrees above horizontal. If the ball lands 24 m away, determine the height of the cliff. 2. if the mass A is 1 kg and the mass of B is 6.0 kg, determine the

    asked by Liz on June 26, 2014
  84. physics

    Rubbing your hands together warms them by converting work into thermal energy. If a woman rubs her hands back and forth for a total of 12 rubs a distance of 7.50 cm each and with a frictional force averaging 30.0 N, what is the temperature increase? The

    asked by Eric on July 19, 2013
  85. English.. Literature... books

    can u give me multiple choice questions from the "examview" on the story "A Noiseless Flash" from Hiroshima by John Hersey ... i really need to practice this selection. Plz if u can, copy and paste the questions because the link you might send me would not

    asked by tara on March 11, 2011
  86. Early Childhood

    Mrs. Bates watched David work a puzzle that he had chosen from the ones she put on the table. She listened and commented when David made guesses at the correct location for the pieces. This is an example of a/an __________ activity. A. structured B.

    asked by Teresa on March 12, 2014
  87. Physics

    A med tech student pushes a 30-kg carton of books across the floor of her dormitory by exerting a constant force of 185 N at an angle of 37 degrees with the horizontal. If the opposing force of friction is 70 N, how much work does he do as he moves the

    asked by Paul on February 6, 2012
  88. sociology

    Why did Max Weber fear bureaucracy? He thought it would discourage the growth of capitalism. Bureaucracy dominated individuals with large, impersonal structures. Bureaucracy increased mental health conditions among office workers. Discipline and hard work

    asked by ste on October 7, 2018
  89. English

    What is the main message that the poem "Africa" suggests about the experience of misplaced Africans around the world? a. They are in danger of forgetting their origins if they do not come together. b. They might be enslaved, but they are strong and moving

    asked by Anonymous on December 5, 2018
  90. Economics.

    What does, "What are two strategies might you employ in order to create and maintain a high demand for stained glass windows. Be sure to consider what would work best for your targeted customer base." mean? NOTE: My targeted customers are: In their middle

    asked by Nicole on October 20, 2013
  91. Physics

    A student eats a dinner containing 8.0x10 raised to power 6j of energy. He wishes to do an equivalent amount of work in a nearby gym by lifting a 60kg object. How many times must he raise the object to expand this much energy? Assume that he raises it a

    asked by Reigna on January 7, 2017
  92. physics1111

    Rubbing your hands together warms them by converting work into thermal energy. If a woman rubs her hands back and forth for a total of 14 rubs a distance of 7.50 cm each and with a frictional force averaging 30.0 N, what is the temperature increase? The

    asked by danny on November 12, 2013
  93. Chemistry

    One of the lines in the spectrum of a mercury vapor lamp has a wave length of 254nm. What is the energy, in kj/mol, of this electro magnetic radiation. The work I have done: (6.626 x 10^-34 x 3.0 x 10^8) all divided by (254 x 10^-9.) The answer I

    asked by Casey on July 11, 2010
  94. English

    i need ajectives (5), adverbs(5), similie (1), idiom (1), metphor (1) decribing Violet Beauregarde i reli need this i don't have the movie so i cant not watch it and my some of my internet doesnt work soo i cant watch it on youtube or otha sites so can

    asked by Anonymous on April 11, 2007
  95. Algebra

    Hello ^^ I'm new to this site :0 I was wondering if someone could help me with my schoolwork! I have a bit of a habit of overthinking my work, so I just need it checked by someone to make sure I actually am you know, getting it. The problem is -(5)^-1, and

    asked by Luka on January 31, 2018
  96. Advanced Algebra

    Carmela works at a department store and earns $10.45 per hour. She has $33 removed from every paycheck for medical insurance. If her goal is to earn a gross income of $468.60 in one week, which equation will help Carmela determine the number of hours (h)

    asked by Steve on October 10, 2017
  97. SS CHECK

    2. What is the purpose of the separation of powers? A) to keep ordinary citizens involved in politics B) to prevent any branch from dominating the government C) to distribute work between state and federal levels of government D) to ensure that every

    asked by Katie on November 2, 2016
  98. MATH SUPER URGENT!

    Alfonse cuts half a rectangular lawn, 50m by 20m, by mowing strips of equal width around the perimeter. Bart cuts the small rectangle in the middle that's left. How wide a strip does Alfonse cut so that they share the work equally?

    asked by Ibrahem Safieddine on December 2, 2015
  99. Pre-calculus

    A golf ball is hit with an initial velocity of 135 feet per second at an angle of 22 degrees above the horizontal. Will the ball clear a 25 foot wide sand trap whose nearest edge is 300 feet from the golfer? Will be through with all the word problems soon.

    asked by Lucy on October 19, 2008
  100. chemistry

    Dr bob can you help with my last question for tonights home work please A gas mixture consists of equal parts of methane(molecular weight 16.0) and argon (atomic weight40.0). if the partial pressure of argon is 26.6 kPa what is that of methane in the same

    asked by Andy on May 11, 2010

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918