1. Biology

    In class I had to make an organism and explain how it adapts to it's imaginary environment. We have to explain the amount of food of eats everyday too. my teacher said that Theres a 10% rule to follow but I don't know what it is. Can u help? Do you know

    asked by :)help please on June 7, 2009
  2. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?? a- a fourth organism was measured and found to

    asked by megan on February 23, 2008
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The organism is not alive. D.

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  4. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss the stages of its

    asked by dion on September 30, 2008
  5. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5:

    asked by Maria on October 28, 2016
  6. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes Organism C: 24

    asked by Jenny on November 1, 2009
  7. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it indicates the maximum

    asked by Skye on September 19, 2014
  8. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace parts of an organism. D. When

    asked by Anonymous on October 3, 2013
  9. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace parts of an organism D.)

    asked by Zach on February 29, 2016
  10. 10th grade biology

    you find an unusual organism growing on the bark of a dying tree . Under a microscope , you observe the cells are eukaryotic , have cell walls , and do not contain chloroplasts . Into what kingdom . Would you place this organism ? Explain your decisions ?

    asked by shayla on June 3, 2009
  11. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism? Explain your decision.

    asked by Tara on March 8, 2011
  12. biology

    Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I

    asked by franny on February 25, 2007
  13. biogloy

    What does it take to be a living organism? Living things share 8 characteristics that are listed in Chapter 1 of your textbook on page 19. Think of an organism or cell in which all 8 characteristics are not obvious. For example, coral looks like it does

    asked by Anonymous on June 11, 2015
  14. Biology

    What does it take to be a living organism? Living things share 8 characteristics that are listed in Chapter 1 of your textbook on page 19. Think of an organism or cell in which all 8 characteristics are not obvious. For example, coral looks like it does

    asked by Pulasthi on November 13, 2015
  15. math repost Please Help!

    Hello, In a class of 24 students, every student flips fairly two coins 40 times each and records the results. Assume that the class obtained the expected results when they conducted the experiment. a. Make a bar graph illustrating the combined class

    asked by joe on February 7, 2010
  16. science

    An organism's ability to maintain homeostasis is important to it's survival. Explain why an organism that lives on land has more complex mechanisms to maintain a stable internal environment than organims that live in water.

    asked by Jaci on September 21, 2010
  17. Algebra

    State the possible number of imaginary zeros of g(x)= x^4+3x^3+7x^2-6x-13 this is how far Ive gotten:there are 4 zeros,3 positive and 1 negative If you've found four real zeroes, then there are no imaginary zeroes. You can also see that there are no

    asked by Marissa on August 10, 2007
  18. MATH

    Hello, In a class of 24 students, every student flips fairly two coins 40 times each and records the results. Assume that the class obtained the expected results when they conducted the experiment. a. Make a bar graph illustrating the combined class

    asked by joe on February 7, 2010
  19. 4th grade

    A class can make equal teams of 5 for basketball, or equal teams of 6 for volleyball. Each student in the class was on a team. How many students might be in the class? Please explain.

    asked by brooke on January 14, 2009
  20. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?

    asked by sammi on October 17, 2009
  21. Simple how-to to do in french?

    For my french class i have to do alittle how-to for around 5 min. It has to be something I can explain to the class in french and then the rest of the class make or participate in. I am in french 4. I was thinking of making a unique type of paper airplane

    asked by rebekah on February 27, 2012
  22. math

    Mrs. Roberts organized her class into four equal sized teams. Boys make 3/4 of each of the teams. If there are 2 girls on each team, how many students are there in the whole class? Please answer and explain.

    asked by Anonymous on May 23, 2013
  23. maths

    the class-marks of classes in distribution are 6,10,14,18,22,26,30.find (a)class size (b)lower limit of second class (c)upper limit of last class (d)third class Explain in detail.

    asked by ujjval on February 24, 2013
  24. Biology

    Locate a diagram of an organism with the main organs and structures labeled. Locate a diagram of an organism with the main organs and structures labeled. Briefly explain how the organism in the diagram has evolved physiologically to become suited to its

    asked by Max on October 24, 2011
  25. Precalculus

    "Show that x^6 - 7x^3 - 8 = 0 has a quadratic form. Then find the two real roots and the four imaginary roots of this equation." I used synthetic division to get the real roots 2 and -1, but I can't figure out how to get the imaginary roots. I checked

    asked by Emily on September 20, 2009
  26. biology

    1. name an organism in which the respiratory and circulatory systems are separate. 2. name an organism with a closed circulatory system that is not used for gas exchange. 3. name an organism whose waste gases accumulate in one system but then move to

    asked by Marina on November 25, 2009
  27. science plz help fast

    how do mutualism and parasitism compare ? 1.)at least one organism is helped in both cases 2.)at least one organism is armed in both cases 3.)organisms are only harmed in both cases 4.)organism are only helped in one while organism are only harmed in the

    asked by help in science on November 13, 2015
  28. Bio

    What is an advantage of using an organism's scientific name rather then its common name? A.The scientific name is always given in the native language B.The scientific name is based upon the organism's kingdom and phylum C.The scientific name does not

    asked by Anonymous on April 21, 2016
  29. English

    1. There are some naughty students in class. So you need to discipline them. What will you do if one student makes noisy during the class? - First, I will tell him to be quiet softly. If he continues making noise, I will make him stand at the back. If he

    asked by rfvv on July 12, 2015
  30. English

    1. He should not make a noise. 2. He should not make noise. 3. He should not make much noise. 4. He should not make many noises. (Which ones are correct? Are all correct?) 5. He was the best student of his class. 6. He was the best student in his class. 7.

    asked by John on June 19, 2009
  31. Algebra

    How can you tell an equation's real or imaginary roots just from its graph, without knowing the equation? I have to look ath the graph of a parabola, absolute value, and a negative third degree equation and do so? Are there any links that could explain

    asked by Anneliese on November 2, 2009
  32. science

    Characteristics of Living Organisms Ten characteristics distinguish an object or thing from an actual living organism. All 10 characteristics must be present simultaneously for something to be considered living. The following table lists four of the 10

    asked by Anonymous on July 23, 2008
  33. Algebra

    The function 5x^2+2x-1's domain is all real numbers, according to the answer key. However, I don't know how to factor this to prove it. Could you show me? The function the sq. root of y-10 has a domain of all numbers so that y is greater than or equal to

    asked by Anneliese on November 1, 2009
  34. Bio...DNA

    Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino

    asked by Pet on May 20, 2007
  35. english

    Please help me with this assignment that I have to explain t o class tomorrow. I am confused and don't know where to start. I have to use "SmartArt" to make graphic organizer.I picked chart and my topic is speech. The chart/graphic that I am going to make

    asked by Laura on November 17, 2010
  36. bioloy

    Choose ONE animal species. Your goal is to describe the way in which an evolutionary change might occur for a particular characteristic (trait) of a population of that species as a result of natural selection. The characteristic (trait) could be something

    asked by Kat on July 6, 2009
  37. Science

    A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What determines how this population will change in the next few years? traits

    asked by Anonymous on November 7, 2013
  38. Science

    A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What determines how this population will change in the next few years? traits

    asked by Anonymous on November 7, 2013
  39. Science

    A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What determines how this population will change in the next few years? traits

    asked by Anonymous on November 7, 2013
  40. Science

    Write a paragraph or make a PowerPoint to explain how genetic variation and environmental pressures can lead to change in an organism. Write a second paragraph that describes an example of a plant or animal that has changed due to these factors.

    asked by Brii on April 18, 2016
  41. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct response to the

    asked by Olivia N J on November 17, 2016
  42. Biology

    Please explain briefly about the difference between the words 'community' and 'habitat'. The textbook said "The place where an organism occurs is called its habitat" and "All the populatons of plants and animals in the same habitat make up the community"

    asked by vickers on August 14, 2008
  43. Ms. Sue PLZ HELP!!!(science)

    A portion of the amino acid sequence of an enzyme from a worm is shown below: -Q-Q-Q-Q-N-N-N-C-C Analyze the same potion of the same enzyme taken from several other organisms. Place them in order from most closely related to the worm to most distantly

    asked by Anonymous on May 4, 2015
  44. calling ms. Sue ( another assignment )

    T_T ok so here's another assignment that should be pass tomorrow. please critique and i need help on how can i close this paragraph. "This English 101AYR course is coming to an end. What are your opinions about the hybrid (50% in-class - 50% online)

    asked by healpmerealquick on July 12, 2011
  45. Algebra

    The function f(x)=x^4−10x^3+40x^2−80x+64 has four complex roots, one of which is 2−2i. What is the sum of all real and imaginary coefficients of these roots? i here is imaginary unit i.e. i^2 = -1

    asked by Stranger on March 18, 2013
  46. Science

    Write a paragraph or make a PowerPoint to explain how genetic variation and environmental pressures can lead to change in an organism. Write a second paragraph that describes an example of a plant or animal that has changed due to these factors. Include

    asked by Aaliyah on April 16, 2016
  47. Maths

    The function f(x)=x^4−15(x^3)+81(x^2)−201x+182 has four complex roots, one of which is 3−2i. What is the sum of all real and imaginary coefficients of these roots? Details and assumptions i is the imaginary unit, where i2=−1.

    asked by OIan on April 16, 2013
  48. English

    1. He is so distracted in class. 2. He is focused during the class. 3. They are distracting in class. 4. They are distracted in class. ------------------------------------------ Can we use all the expressions? Do you have some more expressions-adjectives-

    asked by rfvv on March 12, 2018
  49. english

    Compare and contrast your abilities as an academic writer now as opposed to when you began at Axia College. Using four comparatives and four superlatives within your responses, explain what has led to these changes and what changes you will make in the

    asked by rene on October 29, 2010
  50. alg2/trig

    what is the smallest value of k that would make the roots of the equation x^2-2x-k imaginary? please help, no idea how to do this.

    asked by lisa on January 23, 2012
  51. maths

    Suppose z=a+bi, where a and b are integers and i is the imaginary unit. We are given that |1+iz|=|1−iz| and |z−(13+15i)|

    asked by rohit on April 3, 2013
  52. Science!

    Please check my answers! thanks! :) 1. A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What determines how this population

    asked by Kasey on October 9, 2013
  53. Pre-Calculus

    Can you please help me to explain how to divide complex numbers by an imaginary number

    asked by Lily on October 6, 2017
  54. English

    Hi for my english class, we have to make an invention using cheap material that is useful, original, and provides a solution to a problem. We actually have to show the class like a prototype of it and I have no idea what to do! Mines on tuesday and I'm so

    asked by John on December 5, 2010
  55. 5th grade

    A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.

    asked by Diane on February 26, 2010
  56. Science

    In witch type of symbiotic relationship is one organism helped while another organism is neither benefited nor harmed?

    asked by Rebecca on February 26, 2019
  57. science

    A new organism is introduced into a ecosystem. it gets its nutrients from a dead tree. can this organism be described as a scavenger or decomposer

    asked by Angelina on April 29, 2015
  58. A&P II

    Organism A has more juxtamedullary nephrons than organism B. Which of these organisms could concentrate urine more effectively and why?

    asked by Vera on April 30, 2012
  59. science

    Organism A has more juxtamedullary nephrons than organism B. which of these organisms could concentrate urine more effectively and why?

    asked by Anonymous on November 7, 2010
  60. Science

    A new organism is found that is multicellular, does not have a backbone and has six legs. Classfy this organism in two ways.

    asked by Diane on March 9, 2010
  61. Science~

    Please! Please! Please help me really quick! Pleae check my answers! 1. A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What

    asked by Marie on October 8, 2013
  62. Writing

    The propmt is Write a story about a time that I did something that caused me to feel pride in myself. What is this action and why did it make me feel pride in myself. I need help writing a story into this and you proofread and revise my grammaticly

    asked by Rebecca on April 6, 2011
  63. trig

    use the discriminant to solve for the smallest value of b that would make the roots of the equation x^2+bx+5=o imaginary

    asked by jessica on February 2, 2012
  64. Math

    The class with the greatest mean sales in a spring fundraiser will win a prize. The mean for Eric's class is $148. The mean for Natalia's class is $152. Natalia's sales total $150. If Natalia moves to Eric's class, the mean for each class increases.

    asked by Annie on June 17, 2014
  65. Biology

    Which organism is a third-order heterotroph? To what trophic level does that organism belong?

    asked by Becky on September 3, 2008
  66. Science

    A new organism is found that is multicellular, does not have a backbone, and has six legs. How would you classify this organism?

    asked by Anonymous on March 1, 2011
  67. Math help

    In which type of symbiotic relationship is one organism helped while another organism is neither benefitted nor harmed? A: Mutualism B: Predation C: Commensalism D: Parasitism

    asked by Katy on February 20, 2019
  68. Maths

    Suppose z=a+bi, where a and b are integers and i is the imaginary unit. We are given that |1+iz|=|1−iz| and |z−(13+15i)|

    asked by Oian on April 5, 2013
  69. 6th grade

    what is an organism and how do i do a report on how to explain one

    asked by michelle on October 14, 2008
  70. biology

    What environmental conditions would favor sexual reproduction? What environmental conditions would favor asexual reproduction? Organism - sexual reproduction - gonads asexual reproduction - honeybees - Is pillbugs an asexually organism or is a sexually

    asked by Rachel on April 5, 2010
  71. Science

    Question 2 of 4 A portion of the amino acid sequence of an enzyme from a worm is shown below: -Q-Q-Q-N-N-N-C-C Analyze the same portion of the same enzyme taken from several other organisms. Place them in order from most closely related to the worm to most

    asked by Anonymous on October 28, 2018
  72. science (help)

    a portion of amino acid sequence of an enzyme froma worm is shown below -Q-Q-Q-N-N-N-C-C analyze the same portion of the same enzyme taken from several other organisms place them is order from most closely related to the worm to the most distantly related

    asked by Me on June 3, 2014
  73. 11Science

    A diploid organism has five pairs of chromosomes in each somatic cell. Assuming that no crossing over occurs, how many genetically distinct gametes can this organism produce?

    asked by Rebecca on February 15, 2012
  74. biology

    Which of the following are NOT used to classify kingdoms of organisms? a. complexity of the organism b. invertebrate or vertebrate c. method of obtaining nutrition d. type of cell that makes up the organism D?

    asked by Pamela on May 7, 2010
  75. science

    Which of the following can be classified as a bacterial infectious agent? a)an agent that is transmitted by a non-living thing that uses cells to carry out its functions b)an agent that is transmitted by a single-celled organism that can be treated with

    asked by spunky on January 31, 2019
  76. Science

    A portion of the amino acid sequence of an enzyme from a worm is shown below. -Q-Q-Q-N-N-N-C-C Analyze the same portion of the same enzyme taken from several other organisms. Place them in order from most closely related to the worm most distantly related

    asked by Anonymous on November 10, 2013
  77. fixed question (science check plz)

    A portion of the amino acid sequence of an enzyme from a worm is shown below. -Q-Q-Q-N-N-N-C-C Analyze the same portion of the same enzyme taken from several other organisms. Place them in order from most closely related to the worm most distantly related

    asked by Me on June 3, 2014
  78. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water? i guess what i am really asking is does the presence of other moleculs

    asked by lisa on October 18, 2009
  79. Participation

    Some students in my class are very reluctant to speak up in class discussion. What ways could I make them talk but not in an imitidating way? What activities could I do to make sure everyone gets a chance to participate in a discussion topic?

    asked by Joan on October 10, 2008
  80. Math

    the class with greatest mean.will win prize. the.mean of eric class of 148$. the mean of natalia class is $ 152 .natalia sales total is $150.if natalia moves to.eric class mean.of both classes increases... explain how

    asked by Tooba on May 29, 2018
  81. biology

    1.explain how the code that is found in the organism`s genes works 2.describe how the genetic code controls the production of proteins 3.find diagrams to help explain thankyou!

    asked by Ollie on July 9, 2011
  82. Biology

    There are 10 Characteristics of a living organism 1. Composed of one or more cells 2. evolve into a new type of organism 3. carries out and controls a variety of Chemical reaction 4. produces offspring resembling itself. What are 6 more.

    asked by Jenny on March 22, 2010
  83. genetics

    Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?

    asked by franny on February 25, 2007
  84. biology

    Suppose that for an organism, 2n=8. How many chromosomes do the organism's gametes contain?

    asked by Bob on January 19, 2009
  85. AED 204

    Who is most likely to be a part of this socioeconomic class? How do teacher expectations positively or negatively impact this socioeconomic class? How does tracking positively or negatively impact this socioeconomic class? How is financial support for

    asked by bob on January 18, 2010
  86. biology

    22. Discuss how farmers (or dog breeders) use artificial selection to take advantage of natural variation to "improve" a species of organism over time. (3 points) 23. As you can see, these tortoises have different shaped shells and necks. Make a hypothesis

    asked by Mgk_best_music on March 29, 2019
  87. HJC

    • For this assignment, you will view five examples of 20th Century paintings, one each of the following five schools of thought (the slides are labeled): o Impressionism o Expressionism o Abstract expressionism o Minimalism o Primitivism • Then, listen

    asked by asd on April 21, 2010
  88. AED

    Who is most likely to be a part of this socioeconomic class? How do teacher expectations positively or negatively impact this socioeconomic class? How does tracking positively or negatively impact this socioeconomic class? How is financial support for

    asked by troyer0269 on December 21, 2008
  89. Biology

    Describe the interactions between organism and explain why they are important. Thank you!

    asked by Mary on September 7, 2009
  90. biology

    explain how mitosis helps an organism to grow.

    asked by princess on April 24, 2011
  91. Calculus

    find the intervals on which f(x) is increasing and decreasing along with the local extrema. f(x)=x^4 + 18x^2 I took the derivative and got: f'(x)= 4x^3 + 36x When I set this to zero, I get the imaginary number 3i. I can't get test values for an imaginary

    asked by Leah on November 3, 2014
  92. Science! Biology 1

    Question: Which of following best describes the free-energy requirements of an organism? Answer Choices: During times of hibernation large amounts of free energy are required. Free-energy demand is consistent for all heterotrophs. The organism requires

    asked by Carmen on November 14, 2013
  93. Socials

    Make an organizer with the headings Clothing, Housing, Transportation, Earning a Living, and Education. List the factors that made a person upper class, middle class, or working class in Britain during the 18th and 19th centuries. Can someone please tell

    asked by Sara on November 30, 2009
  94. Biology

    Hi! I'd love some clarification on this question Which of the following are NOT used to classify kingdoms of organisms? a. complexity of the organism b. invertebrate or vertebrate c. method of obtaining nutrition d. type of cell that makes up the organism

    asked by ~ on August 9, 2017
  95. bio

    Scientists often want to know if the genetically transformed organism can pass its new traits on to its offspring and future generations. To get this information, which would be a better candidate for your investigation, an organism in which each new

    asked by sam on March 5, 2009
  96. english

    can you please improve these two sentences. im tryingtosay like the newly rich try to act as if their high class but they don't get accepted even if they have money. the majordiffference between the ric and the high class, is manner. here is my sentence:

    asked by yesudas on August 27, 2011
  97. Biology

    How do genes determine the traist of an organism explain in details

    asked by Anonymous on January 6, 2016
  98. science

    describe and explain an example of a feedback system in an organism I have tried and im lost

    asked by natalie on February 14, 2010
  99. Env. Sci.

    Explain how an organism can be dead, yet still considered a biotic factor.

    asked by Neil on October 9, 2012
  100. Math

    The mean for Eric's class is $148. The mean for Natalia's class is $152. Natalia's sales total $150. If Natalia moves to Eric's class, the mean for each class increases. Explain why.

    asked by Riwa on November 25, 2015

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585