1. math

    How can u write a unit rate if a least one term is a fraction? How is this different from writing a unit rate where both terms are whole numbers?

    asked by Anonymous on October 30, 2014
  2. Physics

    a new unit equal of length is equal to 10 M the area of a m square expressed in term of new unit has a magnitude of (1) 0.05 (2) 0.50 (3) 5.05 (4) 5.00

    asked by Mimi on June 29, 2018
  3. education

    What is meant by the term global community? Give an example of how you can participate in the global community as a classroom teacher.

    asked by danie on February 14, 2012
  4. math

    Identify all components of this statement: 3a + 2b = 7. Is this an equation or an expression and why? o Constant o Variable o Term o Expression o Equation

    asked by John on January 24, 2016
  5. Math question

    In an arithmetic series, the 15th term is 43 and the sum of the first 15 terms is 120. Add the first 20 terms of the series.

    asked by Anonymous on June 2, 2013
  6. Algebra 2

    Use summation notation to write the series 2+4+6+8 for 10 term in each of these images, the lower limit of the summation notation is either n=1, or n=0

    asked by Lola on April 13, 2016
  7. Math

    How can you write a unit rate if at least one term is a fraction? How is this different from writing a unit rate where both terms are whole numbers?

    asked by Lydia on September 5, 2013
  8. Math 12

    A hard rubber ball is dropped from a moving van with a height of 5 metres. The ball rises to 80% of the previous height after each bounce. a) determine the total vertical distance the ball has traveled when it strikes the ground the eighth time. b)

    asked by Steven on May 11, 2012
  9. Science 3

    What is characteristic of a main sequence star? A.It has a mass less than the Sun’s B.It has rapid rotation and a strong stellar wind C.Nuclear fusion in the core varies due to the amount of gravitational contraction that occurs and which heavy elements

    asked by Liz on November 2, 2006
  10. PSY202

    One of the reasons that certain advertisements are successful is because viewers want to behave like those they observe. What is the general term that psychologists use to describe this type of behavior? (Points : 1) Operant Conditioning Social Learning

    asked by Anonymous on June 9, 2012
  11. Science

    Where in you body would starches start being broken down when eaten? What process was being demonstrated when you put the three glucoses together? What general term refers to monosaccharaides, disaccharides and polysaccharides because when they break down

    asked by Joe on October 7, 2013
  12. Environmental Science

    The phosphorus, carbon, and nitrogen cycles are termed biogeochemical cycles- bio meaning "living"; geo for the earth (soil); and chemical referring to matter changing form. Explain why this term is appropriate. (I need a short answer)

    asked by Qiayamah on December 22, 2006
  13. accounting

    Can anyone tell me what information would be found ineach of the following groupings on a classified balance sheet, and how that data could indicate the future success or, failure of a business: Current assets Long=term investments Property, plant, and

    asked by Anonymous on August 14, 2008
  14. accounting

    Can anyone help explain what information would be found in each of the following groupings on a classified balance sheet, and how that data could indicate the future success or failure of a business?: Ø Current assets Ø Long-term investments Ø Property,

    asked by Anonymous on August 18, 2008
  15. Geometry

    Prove that a line that divides two sides of a triangle proportionally is parallel to the third side. Be sure to create a name the appropriate geometric figures. Paul walks 25 feet away from his house and places a mirror on the ground. He backs 5 feet away

    asked by Help!! on January 8, 2016
  16. college algebra help******

    Sequences 1. Constructing a Brick Staircase A brick staircase has a total of 30 steps. The bottom step requires 100 bricks. Each successive step requires two less bricks than the prior step. a. How many bricks are required for the top step? b. How many

    asked by Anonymous on December 8, 2015
  17. Gr.12 data management

    There are 52 white keys on a piano. The lowest key is A. The Keys are designated A. B, C, D, E, F, G in succession, and then the sequence of letters repeats, ending with a C for the highest key. A) if five notes are played together simultaneously, in how

    asked by Helen on July 8, 2015
  18. Math Compound Interest

    If $500 is invested at an interest rate of 4.5% per year, find the amount of the investment at the end of 11 years for the following compounding methods. (Round your answers to the nearest cent.) Find a, Anually Find b, SemiAnually Find c, Quarterly Find

    asked by NHick on October 29, 2016
  19. biology

    Which of the following is NOT true of transcription / translation processes in both bacteria and eukaryotes? Select one: a. RNA polymerase reads the template DNA strand to produce the complementary mRNA transcript. b. Translation of a polypeptide can occur

    asked by bobby on November 25, 2013
  20. Science

    15)Which of the following shows the correct sequence of what happens to the water molecules in an ice cube when it is removed from the freezer? 1. the molecules gain enough energy to break free from each other. 2. the ice begins to melt 3. the molecules

    asked by #FreeGucci on March 16, 2016
  21. Accounting

    In its first month of operations, Giffin Company made three purchases of merchandise in the following sequence: (1) 260 units at $5, (2) 360 units at $7, and (3) 460 units at $8. Assuming there are 160 units on hand at the end of the period, compute the

    asked by Allie on October 12, 2015
  22. Accounting

    When long-term investments in bonds are sold before their maturity date, the seller deducts any accrued interest since the last interest payment date from the selling price. A.True B.False

    asked by Mike on June 9, 2013
  23. Finance

    __________ Management involves decisions regarding how much money to retain in a liquid form and how to allocate funds among short-term investment instruments. a. investment b. money c. credit d. liquidity

    asked by Sheliah on October 24, 2013
  24. music

    I need help studying for my term. I need to know how to identify stuff on a staff or musical notation. Like clefs, notes, signatures, etc... How should I remember these? Are there any online resources? I also need to define terms. How do I remember these

    asked by william on January 24, 2008
  25. Oceanography

    Name the 3 major strategies used to prevent the long term motion of sand on beaches. If you wanted to build a house on a barrier island on the southeast coast of the US, where on the island would you build it (be as specific as possible)

    asked by Krysten on April 27, 2010
  26. earth science

    which term is best defined as a measure of the amount of space a subtance occupies? volume It looks like you have answered your own question. If it is three dimensional, it is volume. However, if it is two dimensional, it is area. I hope this helps a

    asked by nena on October 3, 2006
  27. Statistics

    In conducting multiple regression analyses (MRAs), a major technical concern involves any high correlation of predictor (regressor) variables included in the model. The term for this is ....? A. Redundant predictors B. Close "knit" IVs C. Multicollinearity

    asked by Pat on September 2, 2012
  28. Science

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 11, 2013
  29. Science

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 10, 2013
  30. Evolution

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 10, 2013
  31. Science

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 11, 2013
  32. Science

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 11, 2013
  33. Science

    Which experimental approach would be most effective and easiest to clearly determine the evolutionary relationship between these two organisms? a. sequence the same gene in both species to compare their similarity. b. dissect specimens of both species to

    asked by Anonymous on November 10, 2013
  34. philosophy

    Examples of ways Thanatos has affected your behavior. --- Thanatos: Freud uses this term to explain our inner self. He says that inside each of us there is a force, Thanatos, that causes us to do the exact opposite of what we really want to do, it causes

    asked by josh on November 29, 2009
  35. 11

    A ball is dropped vertically from height of 30 meters after bounces.The ball reaches a max height to 60% of height of the previous bounce. What are the terms of the sequence. What is the height to the nearest tenth of a meter of the ball after the tenth

    asked by Annie on March 18, 2013
  36. math

    wat is a trinomial an trinomial is an equation with 3 terms such as 2x+3y-6 that's a trinomial. (a term is the 2x or the 3y or -6.)

    asked by Anais on February 15, 2007
  37. Social studies

    How long is the term of a Senator? 2 years 4 years 6 years life

    asked by Princess Anna on January 1, 2014
  38. accounting

    1. Describe the roles and responsibilities of management and independent auditors in the financial reporting process 2. Define the following three users of financial accounting disclosures and the relationships among them: a) Financial analysts b) Private

    asked by Ariana on October 31, 2011
  39. Algebra

    80. Determine the sum for the arithmetic series: n = 37, t1 = 23, t37 = 203 a. 5631 b. 8362 c. 6742 d. 4181 81. Determine the sum for the arithmetic series: n = 100, t1 = 17, t100 = 215 a. 9900 b. 3350 c. 11,600 d. 990 82. Determine the sum for the

    asked by Holly on May 21, 2013
  40. math

    What is the line of thought or sequence of thought for solving simple algebraic expressions? When I'm asked to solve the expression (5k)k^3....first I check with my list of exponent rules, and there are always a few that could be used to solve the

    asked by Cliff on May 12, 2010
  41. English

    Choose the term that describes the following phrase. Kris was anxious (about her new job) a. infinitive phrase b. adverb phrase c. adjective phrase d. appositive phrase***

    asked by Kaai97 on January 28, 2016
  42. science

    Which term does not describe one of the three categories into which land plants are classified? Seedless vascular plants. Nonvascular plants. Flowering plants. Seed plants.

    asked by Lilli on September 22, 2009
  43. Bio

    Which term does not describe one of the three categories into which land plants are classified? Seedless vascular plants. Nonvascular plants. Flowering plants. Seed plants.

    asked by Max on September 22, 2009
  44. chemistry

    write a balanced chemical equation for the reaction of aluminium selenide with water (to include physical states of reactants and products)to include brief decription of the strategy used and the sequence of partially balanced equations needed to reach

    asked by rikki on January 30, 2007
  45. social studies

    Can you tell me the definition of the term "special purpose map"? Here are MANY examples: http://www.inweh.unu.edu/unuinweh/Mapdatabase/Special%20Purpose%20and%20Historical%20maps_1.html How do you think you can describe these? Please re-post with your

    asked by Camille on September 24, 2006
  46. Math Algebra

    I’m working on factoring trinomials of the form ax2 + bx + c & perfect square trinomials. This chapter explains that a further method will be needed to conduct a trial and check process, in which the middle term is the sum of the products. Here’s the

    asked by Edward on April 1, 2009
  47. bus

    Which one of the following statements describes the actions of an organization practicing TQM?(total quality management) A- Maximize ROI B- Emphasize the short term C- Make improvement goals easy and attainable D- Make customer needs the highest priority

    asked by Anonymous on August 15, 2013
  48. History

    Can you please explain to me what these two things mean? I don't even have an idea. Thank you War generally induces patriotic citizens to work harder for less compensation. War also sometimes clears away outdated infrastructure and allows economy-wide

    asked by Samantha on April 10, 2009
  49. art and music

    Which of the following best defines a curriculum objective? a.A reflection of the teacher's values and beliefs about children b.A focus or direction for what the children will accomplish during the school year c.A specific and short-term intended outcome

    asked by Bev on April 26, 2019
  50. Math

    Dalya received the proceeds from an inheritance on April 5. She wants to set aside enough on April 6 so that she will have $17,000 available on October 2 to purchase a car when the new models are introduced. If the current interest rate on 91- to 180-day

    asked by Thara! on March 13, 2010
  51. Science fair project

    Please help me, i think i have nothing left to do except cry!!! My science fair class presentation is tomorrow but i am not even done, i just started!!!! My parents are upset with me, and i think i will get a F in my report card for science this term, my

    asked by Wimbika on February 15, 2015
  52. economics(gentle man) thankyou

    Define the following term using graphs and mathematical expression a)utility b)util c)iso cost d)indiffernce curve e)budget line f)monopolist g)kiked demand curve h)social exploitation i)profit j)perfect competation market.

    asked by Anonymous on June 15, 2017
  53. Algebra

    Below is a "complete the square problem" from a math help site on the internet. This is the original problem. 4x2 – 2x – 5 = 0 Move the loose number over to the other side. 4x2 – 2x = 5 Divide through by whatever is multiplied on the squared term.

    asked by Elise on November 13, 2008
  54. ENGLISH

    What do you think of when you hear the term academic honesty? How does knowing the difference among original ideas, common knowledge, and plagiarism help you stay honest when you write an academic paper? What are some of the consequences of not being

    asked by ELIZABETH on March 3, 2010
  55. Fitness

    1. When selecting a mode of exercise for a client, it's important to consider the A. amount of interaction with other clients. B. long-term enjoyment of the exercise. C. client's daily caloric intake. D. availability of instructional videos.

    asked by Miss on January 25, 2015
  56. Health

    Only people who chew smokeless tobacco can get oral cancer A. true B. false** Exposure to secondhand smoke carries the same long-term health risks as smoking A. true** B. false

    asked by Beaverly on March 4, 2016
  57. Chemistry

    what term macthes this description? what about the weakest attractions that exist between molecule answered below last one A covalent bond formed between two different atoms in which the bonding electrons are shared unequally a polar covalent bond.

    asked by Bryan on January 10, 2007
  58. writing

    Hi my writing isn't very good Is there a site with exercises so i can improve my writing skills. Like short stuff. I only have 3 weeks till the next term and i don't know how to structure an essay is there a site with some info ? thanks again, Jim

    asked by Jim_R on August 14, 2009
  59. ENGLISH

    I have a term paper and its on the Prohibition era, and i want to know if this thesis is the best, and if not,could you help reform it? thesis: Prohibition of alcohol in the United States during the 1900's was enacted to reduce crime, have a healthy

    asked by chris34 on February 7, 2012
  60. english

    You mean life skills -- two words. http://www.homeworkspot.com/high/lifeskills/ Check out the Topics section. This term includes a whole range of topics. And please don't post your question more than once. Thanks. =) what are lifeskills

    asked by Writeacher on May 17, 2007
  61. math

    What is the mathematical name for the repeating bar that we place over the repetend? This is the term given in the Oxford English dictionary: vinculum. But I seriously doubt many mathematicians would know this Bob. All I've ever heard it called is: that

    asked by bob on September 11, 2006
  62. Science

    Which term do scientists use to describe objects made of ice and rock in the solar system that enters the earth's atmosphere. 1: asteroids 2: comets 3: meteors 4: planet I choose comets or meteors

    asked by Lovely on March 11, 2019
  63. math

    Suppose you borrow $4200 at an annual simple interest rate of 10.5% for a term of 18 months. How much simple interest will you owe? What is the total amount you will have to repay (maturity value)? i am not good at this one working on my problem

    asked by tammy on July 6, 2012
  64. Psychology

    What does the term bruised ego mean when put into dialogue with worls of Freud and Erik Erikson. What are potential reprecussions of bruised ego in both models? What would be the consequence of such a thing in either theory? Is there a big difference?

    asked by Christian on December 12, 2007
  65. English

    Which term correctly identifies the underlined words in the sentence? Having shopped for hours and purchased several items, the family was ready to go home. A. infinitive phrase B. infinitive C. participial phrase D. participle

    asked by Dasha on February 10, 2016
  66. Language Arts

    Choose the term that describes the type of sentence shown. The senior class took a trip to Washington, D.C. and Annapolis for their research project. A Compound** B Simple C Complex D Compound-Complex If not A, I was thinking D.

    asked by Anonymous on December 26, 2017
  67. Biology

    In the cyclic reaction sequence called the krebs cycle, which chemical event does not take place? a.The acetyl group is joined with a four carbon molecule, oxaloacetate. b. Two carbons per cycle are made into CO2 molecules. c. Electrons generated are used

    asked by Muffy on October 15, 2009
  68. English

    "When you're finished", please lock the door. Choose the term that describes the phrase in quotation marks. A.) adverb phrase B.) adjective phrase C.) infinitive phrase D.) appositive phrase I have no clue for this one.

    asked by Cassie on December 16, 2013
  69. MATH

    Which term(s) describe(s) the system? 3x – 2y = 7 –9x + 6y = –10 dependent consistent and dependent consistent and independent inconsistent

    asked by NICK on September 27, 2010
  70. math

    The sum of first 12 terms of an arithmetic series is 186, and the 20th term is 83. What is the sum of first 40 terms?

    asked by josh on January 18, 2015
  71. computers

    what term is given to pieces of computer software that allow you to manage your e-mail from your computer? I say e-mail filters

    asked by Elizabeth on February 22, 2012
  72. math

    what is 320/380 (or in fraction term) in lowest terms? and what is 54 over 126 in lowest terms?

    asked by tiana on March 28, 2011
  73. HEALTH

    What are the Chronic or long term effects of Cocaine users not crack cocaine users?

    asked by Robin on June 5, 2011
  74. MATH

    Which term(s) describe(s) this system? 4x + y = 8 3x – 2y = –5 dependent consistent and dependent consistent and independent inconsistent

    asked by NICK on September 26, 2010
  75. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC

    asked by Jessica on November 30, 2014
  76. operating system

    If /home/jenny/draft and /home/alex/letter are links to the same file and the following sequence of events occurs, what will be the date in the opening of the letter? ... Jenny changes the date in the opening of the letter to January 31, 2003, ...

    asked by Anonymous on September 29, 2010
  77. Calculus

    Okay so I have the following question and I am totally stuck: Newton's Law of Gravitation says that the magnitude F or the force exerted by a body of mass m on a body of mass M given by F=(GmM)/r^2 where G is the gravitational constant and r the distance

    asked by Tracy on October 12, 2006
  78. 1 history question

    The _______ _______ allows congress to make laws to meet the changing needs of the nation. Is it Supreme Court??? ammendment process I would go with "Article 1, Section 8 of the US Constitution." After looking at the question again and my response, I'm not

    asked by Anonymous on August 30, 2006
  79. EAPS

    If a long-term warming trend causes the melting of all the Arctic sea ice, the albedo of the Arctic Ocean would [(increase) (not change) (decrease)] and the temperature of Arctic surface waters would likely [(rise) (remain unchanged) (fall)].

    asked by Anonymous on February 1, 2018
  80. stats

    You are a share analyst for an investment firm and are investigating the return on shares in the Eastern Mining Corporation over the last four years. The return on Eastern Mining Corporation shares over the last four years is presented. Calculate the

    asked by Answer Me on October 1, 2010
  81. Math

    You are a share analyst for an investment firm and are investigating the return on shares in the Eastern Mining Corporation over the last four years. The return on Eastern Mining Corporation shares over the last four years is presented. Calculate the

    asked by Gina on September 28, 2010
  82. History

    the belief that the government can stimulate economic growth by increasing military spending Which term was defined? military Keynesianism military Marxism military Capitalism military Utopianism again i just want you to check. C?

    asked by James on August 7, 2018
  83. Math

    You roll a number cube numbered one to six 12 times. P(5) = two over three. What type of probability is illustrated and why? (1 point) experimental; the result is based on the number of possible outcomes ** experimental; the result is found by repeating an

    asked by Estela on May 4, 2017
  84. Pre Algebra, Check my answers?

    You roll a number cube numbered one to six 12 times. P(5) = two over three. What type of probability is illustrated and why? (1 point) experimental; the result is based on the number of possible outcomes ** experimental; the result is found by repeating an

    asked by Louie on April 13, 2016
  85. Anatomy and Phys 1

    I have a case study that I need to do and I need someone to help simplify it for me. I would greatly appreciate it and thanks in advance! Beginning with depolarization at the neuromuscular junction, describe the normal sequence of events which lead to

    asked by Anon on April 28, 2016
  86. English

    He never gets up before 9o'clock. In these sentence,Is never is the adverb? and Is before is the preposition?.What is the preposition sequence in the sentence strucure? Can I change these sentence structure to Never he gets up before 9 o'clock or He gets

    asked by Bayarbold on June 24, 2011
  87. Trignometry

    1) If

    asked by Anonymous on September 11, 2010
  88. math

    For the following pair of functions, f(x)-x+2, g(x)-√x-1 find each of the following and state its domain: a.) find (f+g)(x) b.)find (f-g) (x) c.) find (fg)(x) d.) find (ff)(x) e.)Find (f/g)(x)

    asked by Chris on July 21, 2014
  89. science

    a) In a database system within a banking application, transaction A is transferring $1200 from account ACC1 to account ACC2. At the same time, transaction B is processing every account record and adding interest payments by increasing each balance by 1.5%.

    asked by Anonymous on October 11, 2018
  90. Theories and issues in working with school-age chi

    The traditional term latchkey children refers to A. children who know how to properly use house keys. B. children who are between the ages of six and twelve. C. the key that children carry to open their door latch. D. the ability to be left alone at home.

    asked by Amanda on October 26, 2014
  91. Algebra

    In my Algebra class I am working with rational expression. I know it is important to understand the differnce between a factor and a term of an expression. Can someone give me the definition for both and explain to me the difference between the two?

    asked by jessica on June 13, 2007
  92. English

    Choose the term that describes the type of sentence shown. The senior class took a trip to Washington, D.C. and Annapolis for their research project. A Compound B Simple C Complex D Compound-Complex I think its C Correct me if I am wrong.

    asked by Blaw on December 14, 2017
  93. Everyone read!!!

    I have to write a term paper for two classes. the teachers are letting us students write only one but the topic has to be scientific. It is going to be 10-12 pages long double spaced. I was thinking Hydroponics but I am worried that I might get bored after

    asked by Alan on March 25, 2009
  94. accounting

    Assume that a company purchases land for $100,000, paying $20,000 cash and borrowing the remainder with a long-term note payable. How should this transaction be reported on a statement of cash flows

    asked by Anonymous on July 27, 2012
  95. math

    can someone please help me solve this problem. A store owner buys supplies from a vendor for $8,450. The term of sale are 2/10, n/30. What will be net amount due if the owner pays the bill by the 10th day after he receives the supplies>

    asked by Tammy on May 28, 2009
  96. Theories and issues in working with school-age chi

    The term distal supervision means A. supervision by a nonworking parent. B. a lack of supervision. C. self-supervision. D. supervision from a distance. Is this answer D.

    asked by Amanda on October 26, 2014
  97. Theories and issues in working with school-age chi

    The term distal supervision means  A. supervision by a nonworking parent. B. a lack of supervision. C. self-supervision. D. supervision from a distance.  Is this answer C.

    asked by Amanda on October 26, 2014
  98. essay excerpt edit

    can someone edit this This racially perceptive scene clearly demonstrates how social separation due to racism will always end in bitterness. On the surface, Radio Raheem is merely speaking of how life is a consistent battle between good versus evil, love

    asked by Christine on June 1, 2014
  99. science

    Linear growth a. is characterized by a rapidly growing population. b. is demonstrated by the sequence 12, 13, 14, 15, 16. c. is illustrated by the numbers 2, 4, 8, 16, 32. d. is characterized by resource use and consumption. e. is characterized by a slowly

    asked by Mohammad on September 3, 2013
  100. math

    SAVE R2000 CASH R9999 DEPOSIT R1000 TERM 24MONTHS MONTHLY INSTALMENT R484,96 ANNUAL INTEREST RATE 26% TOTAL REPAYABLE R13817,66 WHAT IS THE DEPOSIT IF YOU WISH TO TAKE OUT THE HIRE PURCHASE LOAN? I GOT 6.90883 IT IS CORRECT? PLS HELP THANKS U

    asked by portia on September 16, 2015

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930