1. world history

    67. what is the term for the Gernam attacks on merchant and passenger sips carrying American citizens that were resumed in December of 1916 and were largely responsible for he U.S. entering the war on the side of the Allies?

    asked by Roderick on February 7, 2008
  2. finance

    Free Cash Flow 2014- 1,522 2015- 1,834 2016-2,056 consider a cost of capital of 9.6% and that it is expected that the cfs of the company will grow at a rate of 6% long term.

    asked by rweeer on April 10, 2014
  3. english

    State what kind of term, such as mathematical, scientific, political science, history, etc.- 1. ideological 2. constructivist 3. Marxist 4. Vector 5. axiomatic 6. azimuth 7. Matrix 8. hypothesis 9. theory 10. phenomena

    asked by Micah Crabb on September 24, 2012
  4. Physics

    A hollow, spherical shell with mass 2.00 kg rolls without slipping down a slope angled at 38.0 degrees. (a) Find the acceleration, the friction force, and the minimum coefficient of fricition needed to prevent slipping. You will find the moment of inertia

    asked by Karla on March 27, 2007
  5. ethics

    I am suppose to list some characteristics of Orientalism, but there is nothing in my reading that pertains to that. Can someone help me get started please? This is an extremely broad term, referring to countries and cultures from Japan, China, Southeast

    asked by jenna on September 20, 2006
  6. Math

    1.You roll a number cube numbered one to six 12 times. P(5) = two over three. What type of probability is illustrated and why? (1 point) experimental; the result is based on the number of possible outcomes experimental; the result is found by repeating an

    asked by jai on May 18, 2016
  7. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product

    asked by ISSY on June 8, 2013
  8. Creating High-Quality Centers

    Which of the following teachers is using the computer most effectively? A. "I use the computer to manipulate figures and place the actual hands-on manipulatives nearby." B. "I use the computer so that children can manipulate geometric figures." C. "I

    asked by Priscila on March 14, 2017
  9. chemistry

    How do you solve this problem? In a certain industrial process involving a heterogeneous catalyst, the volume of the catalyst (in the shape of a shpere) is 10.0cm^3. Calculate the surface area of the catalyst. IF the sphere is broken down into eight

    asked by Jin on July 15, 2010
  10. English

    1. A coin sinks in water. 2. A coin sinks in the water. 3. A coin sinks in the water of the glass. 4. A coin sinks in the sea [water]. 5. A coin sinks in the river [water]. ------------------------------------- [What about my explanation about 'water' and

    asked by rfvv on October 19, 2017
  11. U.S. HISTORY DEFINISIONS

    these aren't in my book and i have a term quiz tomorrow -farm bloc -wickersham commission -agricultural marketing act -securities -hoover-Stimson doctrine -Hawley-smoot tariff -Clark Memorandum I think you can just use a dictionary. Try searching in google

    asked by INEEDHELP!!! on February 21, 2007
  12. Math

    How much interest would be earned on $24,664.64 if the owner invest the full amount into an annuity in a regular compounded -interest account with the term of 4 years .

    asked by Cheryl on April 12, 2016
  13. tax accounting

    to create a 10 yr term bond schedule with semi annual payments (principal is $10 million); stated interest rate is 8% and market rate is 6%-how would you do it

    asked by M.white on July 17, 2012
  14. chemistry

    molecules of two different compounds contain the same number of atoms of each element but have different arrangement of atoms. which term correctly describes these two substances? a) isomers b) isotopes c) polymers d) none of the above

    asked by help on August 27, 2012
  15. Graphic Design

    what term used to be defined as using a blade to cut a physical photograph so that only a segment remains? 1.) Clip art 2.) Crop 3.) Cut and paste 4.) Typeface Please help me!

    asked by Fox Girl on October 9, 2017
  16. English II B

    What is the term for a magazine that is published on the computer? 1. computerized slide show 2. online publication 3. electronic portfolio 4. electronic bulletin board

    asked by Carl on April 3, 2014
  17. Finance

    Write a 200- to 300-word paper comparing long- and short-term financing. Describe situations in which each type of financing would be used

    asked by Henry on November 28, 2009
  18. chemistry

    molecules of two different compounds contain the same number of atoms of each element but have different arrangement of atoms. which term correctly describes these two substances? a) isomers b) isotopes c) polymers d) none of the above

    asked by help on August 27, 2012
  19. science

    regarding the term nucleus using the follwoing words size ?? density ?? charge - I put positive location - I put the core of the atom Rutherford ??

    asked by bella on November 2, 2007
  20. Social Studies

    Which is the term for a completely structured language that develops from a blending of native languages and introduced languages? a. Pidgin b. Creole*** c. Esperanto d. Dialect

    asked by Kaai97 on November 6, 2015
  21. Social Studies

    Which is the term for a completely structured language that develops from a blending of native languages and introduced languages? a. Pidgin b. Creole c. Esperanto d. Dialect***

    asked by Kaai97 on November 6, 2015
  22. finance

    If you invested $1000 today at a rate of 5% for five years, and periodically you withdrew the interest earned, what type of interest is calculated for during the term of the investment?

    asked by kay on May 1, 2011
  23. Algebra

    Use synthetic division to divide the polynomial 2x^3 – 12x – 5 by x + 4, and write the quotient polynomial and the remainder. [Be careful – notice that there is no x^2 term.] Please Show work.

    asked by Shelly on July 21, 2009
  24. math

    Show that the twenty-first,thirty-seventh and sixty-fifth term of a linear sequnce are consecutive terms of an exponential sequnce whose common ratio is 7/4

    asked by oliver kennedy on April 29, 2015
  25. Algebra

    Use synthetic division to divide the polynomial 2x^3 – 12x – 5 by x + 4, Write the quotient polynomial and the remainder. [Be careful – notice that there is no x2 term.]. Show work.

    asked by Breanna on July 22, 2009
  26. Science

    Which term describes a type of trait that is usually expressed only when an organism has two identical alleles for the trait? A- homozygous B- dominant C- heterozygous D- recessive My guess is A.

    asked by Skye on December 18, 2014
  27. Anthropology

    Frist I like to Thank you Ms. Sue for your assisting. I did finish my project. Now I would like to know. Anthropologist can be apolitical, a-contextual, a-cultural How can an anthropologist be those three things? Explain the term of those three thing

    asked by jimmy on February 18, 2015
  28. math

    The syetem said my answere was incorrect, let me refrase the question. write the ratio as a fraction in the lowest term. compare in hours 51 hours to 5 days

    asked by Jim on August 18, 2010
  29. nutrition and wellness

    The term "foodbourne pathogen" means a microscopic organism coming from a food source that may be harmful to humans. True False true right?

    asked by y912f on July 15, 2009
  30. Science Please Check!

    Which term describes a type of trait that is usually expressed only when an organism has two identical alleles for the trait? A- homozygous B- dominant C- heterozygous D- recessive My guess is D. Please help!

    asked by Skye on December 18, 2014
  31. biology

    If a new family of mountain lions moved into the ecosystem, how wouls that affect the original mountain lion populatoin short and long term

    asked by stacie on September 12, 2007
  32. Accounting

    I can't get the balance sheet, well, balanced. Accounts Receivable 120600 a Land 1500000 a Notes Receivable 61200 a Insurance Expenses 54000 l Accounts Payable 45000 l Interest Expenses 24600 l Common Stock 1896000 o Depreciation -400000 a Net Sales

    asked by Jess on November 30, 2007
  33. social studies

    q. what is the date for each event.list these 3 things in thier correct sequence. Raliegh send barlowe and amandas on an expedition john white leads a group of colonists to roanoke island raliegh sends about 110 men to settle roanoke island I need help in

    asked by My dancer chick on November 17, 2008
  34. Chemistry

    In this experiment 4.0g of ferrous ammonium sulfate is used. Assuming everything else is added in excess; calculate the theoretical yield of the iron complex. Work through the entire reaction sequence; do not simply assume the number of moles of limiting

    asked by Simin on February 12, 2018
  35. art

    Hi i've already posted a question before but i forgot to add some information I need some help with my art project. I need to choose 2 headlines out of: - anything you can do.. - cuts will lead to riots in cities - life was in the oceans 200m years before

    asked by dee on September 22, 2009
  36. 10th grade

    in this geometry sequence, i have a 90 degree angle, 135 degree,157.5 degree & i need to know the next angle. please help!

    asked by girl on August 26, 2008
  37. math

    the inverse cosine of negative 0.947 Put it in your calculator... The sequence of keys in my old ten dollar calculator is .947 +- 2nd COS Other calculators have different keys strokes. If you want to be neat, type this into a google search window:

    asked by latoya on November 3, 2006
  38. Astronomy - help!

    The earliest fossil records indicate that life appeared on Earth about a billion years after the formation of the solar system. What is the most mass that a star could have in order that its life-time on the main-sequence is long enough to permit life to

    asked by anonymous on October 29, 2008
  39. FIN

    1. Current assets that a firm must carry even at the trough of sales are _____________, while current that fluctuate with seasonal or cyclical variations in sales are _____________. a. temporary assets; permanent assets b. permanent assets; temporary

    asked by BOBBY on September 12, 2007
  40. Ed tech

    Writing a story with proper sequence and organization is important because. It helps the reader understand the story. (MY ANSWER) Stories can be confusing. It helps the reader match the pictures to the text. Stories can be in any order.

    asked by LOVE on August 11, 2016
  41. early childhood

    beginning child story tellers 1 .have story sense and story grammar immediately 2. sequence story events in mature ways 3 .often tell a series of unrelated events 4. display mature gesturig ability is it 3

    asked by reema on June 5, 2012
  42. maths

    pictures are numbered in sequence from 1 to 152.Zack is sticking 8 pictures in order on a bristol board to form posters. a)How many posters can Zack make? b)On which poster can picture numbered 60 be found?

    asked by indira on May 5, 2017
  43. math

    1)Find the third iterate x3 of f(x)=x2-4 for an initial value of x0=2 A)-4 B)4 C)12 D)-12 I chose C 2)Use Pascal's triangle to expand:(w-x)5 This ones long so I chose w5-5w4x+10w3x3-10w2x4+5wx4-x5 3)Use the binomial Theorem to find the third term in the

    asked by Jon on December 13, 2007
  44. Socials

    Radison and Groseilliers were a benefit to the English--how come-- what occured because of this association? Where were the HBC posts located? With what native groups did they rely on for furs? Describe what the term "Made Beaver" means. Radison and

    asked by Sara on January 19, 2010
  45. Ed tech

    If you were writing a timeline of a historical period, what type of graphic organizer would you most likely choose to use your prewriting to help with time order? most likely choose to use in your prewriting to help with time order? Word web. Sequence

    asked by LOVE on August 11, 2016
  46. arithmetic

    From two towns 507km apart, Dave and Bill set out to meet each other. Dave travels 1km the first day, 3 the second, 5 the third, and so on in an arithmetic sequence, while Bill travels 2km the first, 6 the second, 10 the third, etc. How many days after

    asked by Kim on June 29, 2019
  47. Statistics

    A die that is fair will have each face of the die come up one-sixth of the time in the long run. The population for die throwing contains the results of throwing the die an infinite number of times. For this problem, the parameter of interest is p is the

    asked by Kate on March 9, 2010
  48. English

    p w s a f m l x copy the letter string above on a piece of paper. cross out the second and last letters. replace all vowels with the letter C. Insert an O before the second C. cross out the first and third letters. Double the second letter. which letter

    asked by mary on March 12, 2013
  49. Math

    1) Describe the relationships you discovered in the Fibonacci sequences. 2) what strategies did you use to search for relationships. 3)how many examples of a relationship do you need to check before you start to believe that the relationship might be true

    asked by Saru on September 28, 2013
  50. Math

    56) 1, 8,27,64,125, ... What is the next number in the sequence above? (I got 216) 75) A company wants to study 6 brands of soap by comparing each brand with every other brand, if each comparison costs $ 2,000, how much will the company spend altogether?

    asked by Just checking on June 26, 2018
  51. History

    Rule by tyranny or by a leader with absolute power is called __________. Monarchy? Which identifies a contagious disease spread by the bites of fleas carried by rats that killed up to 60 percent of Medieval Europe’s population? bubonic plaque? A breakup

    asked by malia on November 3, 2017
  52. algebra

    2. The level of thorium in a sample decreases by a factor of one-half every 2 million years. A meteorite is discovered to have only 8.6% of its original thorium remaining. How old is the meteorite in millions of years? 2) You need to show how you use the

    asked by sara on June 14, 2009
  53. Finance

    Dave and Marlene live in the boston area. two choices 1) short term trading and bond swap what basic trading principles is involved?

    asked by Terry on November 8, 2010
  54. algebra

    Use synthetic division to divide the polynomial 2x3 – 45x + 28 by x + 5, and write the quotient polynomial and the remainder. [Be careful – notice that there is no x2 term.]. Show work.

    asked by Wizard on November 23, 2010
  55. AP European History

    Is the term renaissance a valid concept for a distinct period in European History or was the renaissance just a continuation of the Late Middle Ages? Support your answer.

    asked by Keegan on September 29, 2011
  56. history

    Which identifies the term for the genocide of more than 6 million Jews by the Nazi Regime during World War I? the Holocaust Nanking Massacre the Killing Jewish Massacre is it A?

    asked by Monica on July 30, 2018
  57. algebra

    Use synthetic division to divide the polynomial 2x3 – 45x + 28 by x + 5, and write the quotient polynomial and the remainder. [Be careful – notice that there is no x2 term.]. Show work.

    asked by Math Loser :( on November 22, 2010
  58. Term Paper question

    I've started writing a term paper and wondering if there is anyone or any place that I could submit my paper and get feedback before it's graded? It's worth a large portion of my grade & I'd like someone to review it when I'm done.

    asked by FI2014 on March 18, 2014
  59. math

    please explain #urgent the sum to infinity of a convergent series is 243. the sum of the first five terms is 242. how do you determine the values of the common ratio and the first term

    asked by charlie123 on February 19, 2015
  60. Math

    Remove the xy-term by rotation of axes, reduce the resulting equation to standard form and trace the curve on the new axes: 13x^2-10xy+13y^2=72

    asked by Ally on May 18, 2015
  61. Business

    Can someone help me please Which type of financial ratio statement is used to judge how well an organization will be able to meet its short-term financial obligations? a- Debt B. Activity c.-liquidity D. Profitability I have: C

    asked by Evelyn on May 18, 2015
  62. Reading

    ) Which of the following industries most likely originated the business-speak term "bandwidth"? A. Finance B. Real Estate C. Technology D. Health care I think the answer is C. Can someone please check my answer?

    asked by BARNETTA on August 17, 2015
  63. Social studies

    How did George Washington create and shape our community? would these be a few ways he created a cabinet system he created the first bank he set the term limit of the president

    asked by Tommy on October 4, 2016
  64. business

    examples of short and long term finance, also state possible pros and cons of examples. please could someone help me out, point me in the right direction or give me links to helpful websites. thank you

    asked by sam on November 6, 2007
  65. American government

    Which of the following bodies sets the term for debate and voting on legislation in the house of Representatives? A. The democratic B. The Republican caucus C. The committee on committees D. The rules committee Is it C or D?

    asked by sallie on March 12, 2016
  66. chemistry

    Hey, I was just wondering if anyone has previous chma11 term tests, or has sample questions or anything to help study for the test..if so can u post the questions here..or lets figure something. thnx

    asked by 123QWE on June 4, 2009
  67. Art

    which is the best definition of the term symbolism? The use of an unknown image The practice of thinking in symbols The use of signs to give directions The use of symbols to represent ideas •• Correct me

    asked by Becky on February 17, 2016
  68. socscie

    -what is sociological imagination? -who was credited for coining the term sociology? -what is the focus of sociology? -what concept is attributed to the ability to see the personal trouble as public issues?

    asked by klyd on July 16, 2010
  69. maths 4th grade

    In end of term tests Zanna got the following marks mathematics 54/75 history 27/40 geography 39/50 english 48/60 french 25/40 art 15/20 what was her best subject her 2nd best her 3rd her 4th her 5th her 6th please show workings

    asked by montana on June 26, 2009
  70. critical thinking

    A common term for photographs, cartoons, advertisements, illustrations, drawings, PowerPoint slides, and graphics used to help present information is A. representers. B. ocular enhancements. C. sight perks. D. visuals. my answer is d.

    asked by Saddia on March 21, 2015
  71. Finite Math

    A sinking fund is the accumulated amount to be realized at some future date (the end of the term) when a fixed number of periodic payments are paid into an account earning interest at the rate of i per period.

    asked by Greg on July 24, 2013
  72. Physical science

    Give one word or term of the following descriptions 1. A reaction that results in the formation of an insoluble salt 2.the process in which ions whithin an ionic substance are separated 3.the positive ion 4.a proton acceptor

    asked by Plz help on September 10, 2014
  73. english

    . A sinking fund is the accumulated amount to be realized at some future date (the end of the term) when a fixed number of periodic payments are paid into an account earning interest at the rate of i per period

    asked by lashay on August 3, 2015
  74. health

    The term challenge for cause refers to a A. request to dismiss a juror because of possible bias. B. procedure questioned during the discovery stage. C. judge’s decision to subpoena a witness. D. plaintiff’s dispute regarding a physician’s

    asked by Anonymous on April 18, 2009
  75. soclal studies

    how were goods and services traded by barter I teach your children how to read and write; you provide me with room and board for the school term. It's a trade! =) what tools do Native Americans used? it is chaper ten

    asked by mckayla hobbs on February 6, 2007
  76. world history

    what is the term for the policy of qvoiding conflict that the the United States had originally pursued during the war that was based on the belief that the country should maintain a limited involvement in world affairs while trying to broker a peace?

    asked by Seth on February 7, 2008
  77. Environmental Science

    A hole that is dug into the ground to obtain fresh water is called a.the recharge zone b.a well c.an aquifer d.a watershed a. right? I don't agree with that... re check Try http://www.answers.com and look up each term. Then let us know what you think the

    asked by Mack on April 20, 2007
  78. Confidentiality in Allied Health Part 1

    The term challenge for cause refers to a a.request to dismiss a juror because of possible bias. b.procedure questioned during the discovery stage. c.judge's decision to subpoena a witness. d.plaintiff's dispute regarding a physician's malpractice.

    asked by Anonymous on December 2, 2011
  79. political theory

    I don't have an assignment due, but I'm having trouble understanding the themes that are in the Persian Letters by Montesquieu. Has anyone read them? I'm in college. I'm having trouble understanding the Harem sequence, and these themes: lack of self

    asked by bayley on March 3, 2015
  80. Physics

    An athlete starts at point A and runs at a constant speed of 5.40 m/s around a round track 250 m in diameter. Find the x component of this runner's average velocity between points A and B. (answer is 3.44 m/s) Find the y component of this runner's average

    asked by Josh on September 13, 2006
  81. Grammar

    Can someone please help me check these for me.And help me correct them the correct way. I'LL APPRECIATED YOUR HELP :) I have to rewrite the sentences under the grammar rule of "Punctuating Sentences" if they need no change i have to write no change. (1)

    asked by PatriciaQuinn on October 30, 2006
  82. History

    1. Which of the following did George Washington do during his presidency? -established a cabinet of advisers** -limited himself to one term in office -offered military support in foreign wars -served ties with Great Britain 2. What precedent did George

    asked by Mason on December 1, 2015
  83. math

    Let S be the set of all measurable functions on [0,1]. Then the set O of all functions in S equal to 0 a.e on [0,1] makes an additive subgroup of a commutative group S. Show that S/O with the distance p(f,g)=indefinite

    asked by sxxx123456 on January 15, 2009
  84. Calculus

    Using the sequence below, write out a formula for the balance in the account n years after December 1996: Years Balance 1996 = $20,000 1997 = $22,000 1998 = $24,200 1999 = $26,620 2000 = $29,282 r = 1.1 and 2006 = 51,874.8492 Thanks

    asked by Hester on July 12, 2012
  85. Finance

    1. What is an entrepreneur? (1 point) a sole proprietorship a corporation one who opens a new business a bank that loans money 2. Which of the following is the best definition of probable operating costs? (1 point) Amount of money required to start a

    asked by D on April 15, 2018
  86. biology test

    study guide last one purpose of 3 types of RNA My answer 1. rRNA - bonds proteins and mRNA to provide the site of protein synthesis 2. tRNA - is used to pair their anticodons with the matching condons on the mRNA strand 3. mRNA - is to be the transcript of

    asked by sam on March 10, 2009
  87. probability

    Please help me solve this problem step by step pleaseeee! The probability that an archer hits the target is p= 0.8, so the probability that he misses the target is q = 0.2. It is known that in this situation the probability that the archer hits the target

    asked by Selena on August 12, 2015
  88. Business Statistics

    Using the telephone numbers listed in your local directory as your population, randomly obtain 20 samples of size 3. From each telephone number identified as a source, take the fourth, fifth, and sixth digits. Calculate the mean of the 20 samples Draw a

    asked by Kim on October 8, 2013
  89. MATH PLS HELP

    19 WorkPad Note: In questions 19-21, remember to show all of the steps that you use to solve the problem. Be sure to use the text box where the question mark (?) first appears to show your mathematical work. You can use the comments field to explain your

    asked by zed on April 27, 2016
  90. college algeb

    help :) 1.) cube root of 3x^2 multiplied to square root of 2x? 2.) square root of 3+2sqrt2 multiplied to sqrt of 3 - 2sqrt2 3.) sixth root of 12 divided by (sqrt 3 multiplied to cube root of 2) 4.) 4/cuberoot of 16

    asked by alaine on September 9, 2015
  91. maths 6th grade

    a man was trying to swim to a buoy placed at a distance of 200m out in the sea. it took him 1 min to swim 20m. then a wave pushed him back 10m and he rested for about 1min before swimming again. he continued in his way for the rest of their journey. how

    asked by jas on January 10, 2015
  92. Finance

    Given her evaluation of current economic conditions, Ima Nutt believes there is a 20 percent probability of recession, a 50 percent chance of continued steady growth, and a 30 percent probability of inflationary growth. For each possibility, Ima has

    asked by Anonymous on February 13, 2013
  93. government

    1. Which answer BEST describes the role of a linkage institution? A. to discourage average voters from voting B. to improve the influence corporations have on policy C. to inform constituents of the policymaking work of the government D. to insulate the

    asked by dbh on June 6, 2019
  94. Arithmetic

    A box in a college bookstore contains books, and each book in the box is a history book, an English book or a science book. If one-third of these books are history books and one-sixth are English books, what fraction of the books are science books?

    asked by Peltier on March 19, 2013
  95. precalculus

    .(a)Determine the number of degrees the axis must be rotated to eliminate the xy term of the conic x2+6xy+y2-6=0. (b)Graph the conic in part a and use a graphing utility to confirm your result.

    asked by Anonymous on December 13, 2016
  96. Algebra 2

    Is my work for this problem correct? Directions: State the possible rational zeros for each function. Question: f(x) = 3x^2 + 2x – 1 Answer: Constant term:-1 Factors: 1 Leading coefficient:3 Factors: 1 and 3 ±1/1,3= ±1/1,3 and ±1/1,3 = ±1/1 and ±1/3

    asked by Rudy on November 19, 2015
  97. computers

    If a term paper consisted 42 pages,each containing 40 lines of 100 symbols each (counting each space as symbol)was to be encoded using unicode, how many bytes of storage space would be required?

    asked by Ryan on October 25, 2009
  98. Accounting 111

    Would the loss on retirement of long-term debt be added to or deducted from net in come in determining net cash flow from operating activities by the indirect method?

    asked by Rochelle on April 29, 2015
  99. math

    what is the equation of the line in slope-intercept form or x=c with the given formation. Slope is in the lowest term as an integer or fraction (not decimal, not still divided by 1). What is substituted in as it is solved? Through (2,15), parallel to

    asked by Adrian on November 9, 2015
  100. Organic CHM Lab

    a) what is meant by the term flooding of the fractionating column and what causes it? b) Assume that no azeotropes are formed, would it be easier to separate n-hexane and benzene or n-hexane and toluene by distillation? expalin? Thank you!

    asked by Kim on September 9, 2014

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930