1. Health please check my answer

    Please check my answer thanks True or False The term malignant, when used in reference to hypertension is a treatable cancer I said True

    asked by Graie on April 8, 2008
  2. Math

    An investment earning simple interest at a rate of 1.10% per annum for a term of 5 years earned $82.50 in interest. What was the principal?

    asked by Rafiki on May 8, 2014
  3. Science

    Would heavy snowfall in the ogallala aquifer region affect the recharge of ghe aquifer over the long term?

    asked by Niki on December 10, 2017
  4. Language

    What is the term for the part of the story that sets up the story's ending? A)Exposition B)Conflict C)Falling Action D)Resolution C? Please Help!!

    asked by Need Help on August 15, 2014
  5. math 11

    An investment earning simple interest rate of 1.10% per annum for a term of 5 years earned 82.50 in interest. What was the principal?

    asked by karen on April 5, 2012
  6. Cultural Diver in the Classrm

    When you hear the term culturally different, what group comes to mind first? Describe this group and its looks, language, behaviors, attitudes, and lifestyles.

    asked by Anonymous on April 11, 2011
  7. Health please check my answer

    Please check my answer The term neoplasm refers to what ? A. invasive carcinoma B. malignant growth C. growth of a tissue D none of these I say it's B

    asked by Graie on April 8, 2008
  8. PHI 208

    Hill refers to the ability to understand oneself, to face oneself, and to be honest about the kind of creature one is by this term

    asked by ANDREW on July 19, 2014
  9. Health

    Repetitive and short-term exercise require anaerobic energy. True or false My answer is true

    asked by Faye on August 18, 2014
  10. Pre Cal.

    The expression 81p^4 + 108 p^3 r^3 + 54p^2 r^6 + 12 pr^9 + r^12 is the expansion of which binomial? A: (3p+r^3)^4 The fifth term in the expansion of (3x^2-sqrt(y))^6 is _______. A: 135x^4y^2

    asked by Jeremy on August 13, 2009
  11. Health

    Repetitive and short-term exercises requires anaerobic energy. True or False My answer is False

    asked by Faye on August 18, 2014
  12. biology

    explain and illustrate how the long-term survival of a species depends on resources that may be limited from time to time

    asked by Tooba on May 4, 2010
  13. english

    define the term cliche and write one sentence that has a cliche in it. can u help i know it's easy but i want different exaples the book is kinda dull.

    asked by chuck on August 2, 2009
  14. science

    Which term refers to the diffusion of water through a membrane? A. osmosis B. engulfing C. active transport D. facilitated transport

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 23, 2014
  15. science

    how do i draw a diagram to show the meaning of the term newton? Use the 1-kg mass in the drawing. It must show the gravitational pull

    asked by Twilight lover on June 2, 2009
  16. maths

    What is the smallest positive common difference of a 6-term arithmetic progression consisting entirely of (positive) prime numbers?

    asked by rohit on March 21, 2013
  17. World History

    In 1450-1750 what was the exact term for the government used in Russia? Absolute Monarchy? Parlimentary Government? ect...

    asked by Danielle on October 9, 2007
  18. science

    A sample is composed completely of gold, absolutely free of impurities. Which term or terms could be used to describe this sample?

    asked by jug on September 14, 2008
  19. Math 11

    An investment earning simple interest at a rate of 1.10% per annum for a term of 5 years earned $82.50 in interest. What was the principal?

    asked by Chuck on April 9, 2012
  20. history

    What incident abroad marked the election day of the 1956 election, thereby enhancing Eisenhower's bid for a second term?

    asked by howard on September 26, 2013
  21. Psy202

    After hearing about some possible causes of sneezing, a scientist decides that room fresheners are the most common cause. What is the term that describes the scientist thinking

    asked by Monica on March 29, 2013
  22. chemistry

    Which term has the same numerical value for the forward reaction as it has for the reverse reaction, but with opposite sign? a. ^E ( delta E) b. Ea1 c. Ea’ d. Ea2

    asked by mona on December 13, 2014
  23. Business

    19. The price for predictability is often A. long hours. B. long-term boredom. C. stress and insecurity. D. increased self-confidence. I think D or a

    asked by Jay on March 26, 2015
  24. math

    An investment earning simple interest at a rate of 1.10% per annum for a term of 5 years earned $82.50 in interest. What was the principal?

    asked by Snorlax on April 15, 2014
  25. Physics

    You are explaining to a cousin what it really means to het something up in reference to a handshake and what term means and why it never ends (micro wise)

    asked by Alicia on May 13, 2011
  26. Science

    What is meant by the term "salting out" in the liquid-liquid extraction procedure?

    asked by King on March 14, 2011
  27. Precalc

    1) expand (1+3x)^4 using the Binomial Theorem. 2) Use Pascal's Triangle to expand(x+2)^5 3)What is the third term of (a+b)^11?

    asked by 95 on January 8, 2012
  28. Math

    If my mid-term is worth 15%, and my grade is 100% right now. If I get 0 on the exam, my grade would be 85% right?

    asked by Thom on October 23, 2013
  29. Algebra

    Factor: 3x^2 - 27 3x^2-27=0 27+(3x^2-27)=0+27 3x^2=27 (3x^2)/3=27/3 x^2=9 x=3 Since there is 3x^2, one term must contain 3x and the other x. 27 factors into 3*3*3 or 3*9. With this information, you should be able to factor it yourself. I hope this helps.

    asked by Sarah on July 29, 2007
  30. culture diversity

    What's the common definition term of social ranking by social wealth

    asked by kenny on May 14, 2009
  31. programming

    Explain the term "dynamic memory allocation" in C++? Please explain it in such a way i will understand it

    asked by Olumide Adesiyan on April 23, 2014
  32. Chemistry

    Use an analogy from everyday life that can define the term half-life

    asked by Nikkie on June 1, 2016
  33. Math

    b) an explicit formula for the general term (2 marks) c) t20 (2 marks) 7/4, 1, 1-4, -1/2

    asked by Alex on September 18, 2014
  34. biology

    Small gene big plasmid Question 2 Part E wrong. Question 2 Part F Determine the DNA sequence of PCR products. I do not understand how to handle this problem. On home works they were wrong and the solutions were confusing. Please give me a clue.

    asked by Al on November 16, 2013
  35. math

    The total hours allotted for writing and oral competition is 2 three fifth hours. The writing competition is allotted 1 hour and five sixth. How many hours are allotted for the oral competition

    asked by Anonymous on April 9, 2013
  36. Biology

    A student attempts to locate start codons in a region of the genome without the use of the computer algorithm. How many start codons are in the DNA sequence below? Remember, phage use three different codons to indicate the potential start sites of genes

    asked by trenton on September 10, 2018
  37. Marh

    An automobile manufacturing plant produces cars according to a fixed pattern. During one day, the first five cars have the following colors and equipment. blue with a stereo and dark interior white with a stereo and.light interior- green without a stereo

    asked by Sandy on March 16, 2016
  38. Microeconomics

    A computer company produces affordable, easy-to-use home computer systems and has fixed costs of $250. The marginal cost of producing computers is $700 for the first computer, $250 for the second, $300 for the third, and $350 for the fourth, $400 for the

    asked by Alexys8 on January 24, 2017
  39. PSYCH

    Two common confounding variables that must be controlled in a nonequivalent control-group design are: A. selection and regression to the mean. B. selection and maturation. C. maturation and regression to the mean. D. sequence effects and maturation. MY

    asked by MAE on June 20, 2015
  40. English

    Hi i have to write an essay about The Sun Also Rises by Ernest Hemingway..i was wondering what some thesis statements would be.....is In this book the lost generation was a term that described how the main characters lived their lives? im not sure thanks

    asked by Jake on November 19, 2009
  41. Math

    Choose the most specific term that will make the following statement true. Do not assume anything more than the information given. I am a ____ because my opposite sides are congruent and parallel. square rectangle parallelogram rhombus

    asked by lina on April 13, 2014
  42. history

    please help the massive government spending of the New Deal led to a. the end of the Depression b. some short-term economic improvement c. the collapse of capitalism d. extreme shortages of food i'm not sure, B sounds right to me

    asked by history on April 19, 2009
  43. Math

    In conducting multiple regression analyses (MRAs), a major technical concern involves any high correlation of predictor (regressor) variables included in the model. The term for this is…?

    asked by Claudius on January 21, 2019
  44. Critical Thinking

    Please help and Identify the rhetorical devices used by the sentence below and explain. The bill would also adopt a federal ban on late-term procedures that opponents refer to as partial-birth abortions. Thank you,

    asked by Kevin on April 5, 2008
  45. Environmental Science

    Which term is used to describe when genes are transferred from one species of crop plant to another to produce desirable traits such as pest resistance? A) Selective breeding B) Genetic engineering I think the answer is A

    asked by M, S, E on March 23, 2017
  46. Math

    I have 4 math problems that need to be solved by using factoring. I am unable to figure the following out. I have used the FOIL method but it seems not to be working out. I appreciate any help I can get. Thanks ^ exponet 3x^3-7x^2+2x x^2-2x+5

    asked by Mary on April 7, 2007
  47. math

    A rock with weight of 388 n is on a cliff 1800 m high above head.l bull with a mass of 450 kg is running toward you at a speed up 5.2m/s which is more dangerous (term of energy ) defend your answer

    asked by glenn on January 9, 2012
  48. life science

    give the biological term for the following 1.process in biotechnology that is used to make human insulin in a bacterial cell 2.white blood cells produce antibodies in response to pathogens

    asked by lesedi on April 10, 2015
  49. Ethics in counseling

    Two foundational definitions related to counseling ethics and legal issues. Then analyze how each term is reflected in ethical best practice including working with clients from diverse background

    asked by Jackson on December 7, 2011
  50. government

    __________ is the term given to the activities of interest groups that seek to influence the making and implementation of public policy and to persuade government officials to support a group's position.

    asked by cody on April 4, 2011
  51. Trignometry

    Given Triangle ABC: I think there are suppose to be right triangles... 1) If

    asked by Anonymous on September 11, 2010
  52. comm156

    Create an outline that includes details that support your thesis. Outline only the body of your paper. Remember to avoid bias to strengthen your writing (that is, present a balanced case for your thesis). Explain in a short paragraph why you decided to

    asked by rosita on February 22, 2013
  53. Algebra 1

    1.Simplify the expression below (-2w^3)^5 / 8w. What is the value of the exponent on "w" ? 2.Simplify the expression (4x^2 - 3x +1) - (x^3 +2x +7). What is the coefficient of the x term in the simplfied expression? 3. Jack Watson is wroking in a lab making

    asked by Shevani, help me on April 22, 2013
  54. math

    A graph G is obtained from a graph of y by the following sequence of transformations. Write an equation whose graph is G. y=|x|: a shift left 9 ​units, then a vertical stretch by a factor of 7​, and finally a shift down 6 units Thank you so much!!!

    asked by Jessica on September 11, 2018
  55. finance

    Johnson Ltd a manufacturer of office equipment is considering purchasing a new machine for $2,000,000. The company is expecting an annual cash inflow of $1,220,000 from the sale of the products and an annual cash outflow of $350,000 for each of the six

    asked by anonymous on July 9, 2019
  56. PSY

    CAN SOMEONE TELL ME IN EASY TERM HOW IM SUPPOSE TO ANSWER THIS QUESTION LIKE A EXAMPLE THE QUESTION IS DESCRIBE ONE DEVELOPMENTAL THERORY AND CHOSE HOW IT APPEAL TO YOU I KNOWN ITS SHOULD BE SELF EXPLANATORY IM JUST NOT SURE

    asked by LEDA on August 1, 2010
  57. english

    what is the term uncle tom" symbolic of in modern society? I think it still means a black person that wants to please the white society that oppresses him.

    asked by ann on August 14, 2008
  58. real estate financing

    If the interest rate on a $250,500 loan is 6½ percent for a term of 30 years, what is the principal and interest (PI) payment for the first month?

    asked by kathey on September 24, 2012
  59. marketing

    Imagine that you are a mentor to a new employee at a marketing firm. The new employee is having trouble understanding what the term market communication really means.

    asked by Emily on January 3, 2011
  60. Sexually Transmitted Infections

    What are the temporary and unending term results of contracting an STI? I know that STI's are Sexually Transmitted Infections, but I don't know the above question.

    asked by Anonymous on November 17, 2010
  61. English

    What is the term for the part of a story that sets up the story's ending? Exposition Conflict Falling action Resolution Plzzzz help me

    asked by Labbyak on August 31, 2015
  62. to damon

    thanks,,,, my course (which was very word intensive) Never used the term "expand", but went into depth on simple problems with pascals triangle. I think now I understand the principle behind the problems.

    asked by lamar on June 7, 2015
  63. 5th grade math

    How many verticles does a cube and pyramid have? do they both have eight. also if you have a pattern that starts with one block and is increased by three cubes each time what is the tenth term in this pattern? 28 or 31

    asked by jill on February 1, 2011
  64. laws

    I am having trouble with this question some someone help to explain this better to me? What is the difference between licensure and accreditation? Why would a long-term care provider seek accreditation?

    asked by april on May 5, 2010
  65. Maths

    What does the term adaptation mean? how does adaptation explain the patterns of distribution of plant and animal species in the world? I need help.. Can someone give me the answer? Thanks.. :3

    asked by James on February 19, 2018
  66. Science

    The terms diffusion and osmosis seem to have similar meanings. Explain how they are similar. Then give reason why scientists use two separate term.

    asked by Trisha on January 7, 2014
  67. chemistry

    (1) define the term metallic lustre and nonmetallic lustre ? (2) highlight the different between them as well as given two example of each mineral that exhibit the major types of crystal?

    asked by POPPY on April 2, 2019
  68. ethics and moraling reasoning

    Hill refers to the ability to understand oneself, to face oneself, and to be honest about the kind of creature one is by this term: (Points : 1)

    asked by Christopher on February 10, 2016
  69. Chemistry

    What is the general trend in the acidity of Period 3 oxides moving across the Periodic table from left to right? (Be sure to refer to the term acidity.)

    asked by Janet on November 27, 2012
  70. Factor completely

    I am to factor this completely and I am stuck. 2r^3 + 8r^2 +6r Note: x^2 is x-squared (that is, x with the superscript 2), etc. This is a double post. The equation is r but the explanation for the squared term uses x's.

    asked by Bekki on June 12, 2006
  71. English

    While the term _____________ refers to the specific dictionary definition of a word, ___________ refers to its implied or suggested meaning

    asked by Joann on November 11, 2016
  72. math sequence

    A ball is droped from a height of 16 m on each bounce, it rebounds 0.5 of the distance it fell how far has the ball traveled. When it hits the ground for the fifth term?

    asked by Abdela said yimer on January 21, 2012
  73. Algebra

    please help. I am not sure if this is correct. I need to simplify this to the lowest terms a^2 - 4b ^2 _____ ______ a+2b a+2b my answer is: a^2-4b^2 _________ a+2b is this really to the lowest term?? for some reason I think I am doing this wrong. Thank

    asked by Liz on August 5, 2012
  74. Language Arts

    1. What is the term for the part of a story that sets up the story's ending? (1point) exposition conflict falling action ** resolution

    asked by Sadie on September 10, 2016
  75. biology

    The agricultural research facility during a research accidentally changed the DNA sequence of a wheat plant from GCCATGTT to GCGTACTT and this mutation resulted in a stronger plant variety. What kind of mutation did the plant undergo?

    asked by cheyenne on April 23, 2014
  76. biology

    The agricultural research facility during a research accidentally changed the DNA sequence of a wheat plant from GCCATGTT to GCGTACTT and this mutation resulted in a stronger plant variety. What kind of mutation did the plant undergo?

    asked by Anonymous on December 3, 2013
  77. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene. What is the product’s

    asked by Sonya on June 10, 2011
  78. stats

    2. The modern Olympic Games are a modified revival of the Greek Olympian Games that came to be largely through the efforts of the French sportsman and educator Baron Pierre de Coubertin. The Games are an international athletic competition that has been

    asked by leah on September 30, 2016
  79. Science, need help please!!

    Please help me with this science, thank you!! The sun is a mid-sized, main sequence star. What stage is next in the life cycle of the sun? A red giant B blackhole C white dwarf D neutron star ------------------------ Astronomers study many different kinds

    asked by Anonymous_potato on October 26, 2017
  80. science

    When a H II region is observed, it signals what stage in stellar formation? A the initial collapse of the interstellar cloud B the formation of planetary nebulae C the prostar stage D the zero age main sequence stage E depending on their masses the stars

    asked by bolometric on February 8, 2007
  81. FIN

    1. Current assets that a firm must carry even at the trough of sales are _____________, while current that fluctuate with seasonal or cyclical variations in sales are _____________.(b) a. temporary assets; permanent assets b. permanent assets; temporary

    asked by sandtara on September 14, 2007
  82. FIN-check this please

    1. Current assets that a firm must carry even at the trough of sales are _____________, while current that fluctuate with seasonal or cyclical variations in sales are _____________.(b) a. temporary assets; permanent assets b. permanent assets; temporary

    asked by sandtara on September 14, 2007
  83. Finance

    I answered the following questions, butI just want to make sure Im on the right track. Please assist... What are the differences between shareholder wealth maximization and profit maximization? Shareholder wealth maximization strictly relates to the market

    asked by Greatdanelola on September 17, 2008
  84. math

    i'm supposed to come up with different questions for 11-12 year olds, 13-14 year olds, and 17 year olds. the topic is the triangular number sequence. any ideas for them?

    asked by alex on March 4, 2010
  85. calculus

    consider the function f(x)= x^2/4 -6 Rn is the Riemann sum where the sample points are chosen to be the right-hand endpoints of each sub-interval. Calculate Rn for f(x)= x^2/4 -6 on the interval [0,4] and write your answer as a function of n without any

    asked by amanda on November 30, 2006
  86. chemistry

    1. Pouring liquid nitrogen onto a balloon decreases the volume of the balloon dramatically. Afterward, the balloon reinflates. Use the kinetic theory to explain teis sequence of events. Temperature of liquid nitrogen is -196 degrees C.

    asked by Anonymous on January 23, 2008
  87. Chemisty

    Pouring liquid nitrogen onto a balloon decreases the volume of the balloon dramatically. Afterward, the balloon re-inflates. Use kinetic theory to explain this sequence of events. The temperature of liquid nitrogen is -196 degrees Celsius

    asked by Kelly on April 27, 2017
  88. math

    A netball team scored 60,42,48 and 46 goals in thier first four matches. a)What is the mean number of goals for the first four matches? b)The team shoots only 39 goals in the fifth match.What is the mean number of goals scored for the fine matches? c) The

    asked by Mike on May 20, 2018
  89. Math

    Lawrence records the number of minutes he reads each day show below Day 1: 75 mins Day 2: 30 mins Day 3: 25 mins Day 4: 50 mins Day 5: 80 mins How many minutes must Lawrence read on the sixth dat of have mean of 55 minutes read for the 6 day?

    asked by Dani on April 18, 2011
  90. accounting

    Analyze the following separate errors and describe how each would affect the 10-column work sheet Below. Explain whether the error is likely to be discovered in completing the work sheet and, if not, the effect of the error on the financial statements. a.

    asked by Bonnie on May 23, 2009
  91. SCI LAB

    In my science lab we tested anaerobic vs aerobic respiration. for the anaerobic we covered the test tubes with a plastic film. what is the term for that?

    asked by Quick question on March 9, 2008
  92. algebra

    I'm really confused on substitution. My teacher has a terrible accent and cannot understand what she says. i get the basics myself but i'm pretty confused on the following problems: 1) y= 3x - 8 y= 4-x 2) 2x + 7y = 3 x=1- 4y 3) x = 2y 4x + 2y = 15 Any

    asked by Daisy on January 25, 2010
  93. Sociology

    How would eating disorders factor into the media/cultural aspect of sociology? Would they be considered an unintentional/long term media effect?

    asked by Sarah on April 26, 2012
  94. Maths

    The sum to infinity of a convergent is series is 243.The sum of the first five terms 242.Determine the values of the common ratio and the first term

    asked by Nonkululeko on February 25, 2017
  95. Chemistry

    What is meant by the directionality of a spontaneous reaction? I haven't heard of the term but I assume it means the direction in which a spontaneous reactions occurs.

    asked by Mary on February 11, 2007
  96. math

    f(x)=(x+1)^3-2 1. Describe the long term behavior of this function. Give the power function that f resembles. 2. Determine the number of turning points f has.

    asked by Ann on August 30, 2011
  97. math

    Compute the monthly payments for an add-on interest loan of $850, with an annual interest rate of 15 percent and a term of 4 years.

    asked by mac on May 2, 2014
  98. staticis

    3. When you add the values 3, 5, 8, 12, and 20 and then divide by the number of values, the result is 9.6. Which term best describes this value: average, mean, median, mode, or standard deviation

    asked by Norma on September 7, 2010
  99. art

    3.Which is the definition of the term contemplate? A.to quickly complete a task B.To consider throughtfully C.a new style of art D.to consider throughtfully over an extended period of time

    asked by Jake on March 6, 2015
  100. Medical Terminology

    A 65-year-old patient has a murmur over the apex of the heart. What does the term apex represent? A. Tip B. Nearest the middle C. Front D. Back

    asked by Brenda on March 26, 2010

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930
  931. 931
  932. 932
  933. 933
  934. 934